... (CA) revealed only a thin CA line between the lumen of the esophagus and the mediastinal paraesophageal abscess/CA depot (es, esophagus; ao, aorta) abscess formation was necessary Other than ... scan revealed persistent and significant CM leakage with gradual abscess formation and advancing mediastinal emphysema At the same time, the CT scan showed only a thin filament-like CM fistula ... potassium chloride, sodium ascorbate, ascorbic acid and the additives aspartame, acesulfamepotassium, orange/lemon aroma, maltodextrin and sugar She followed the manufacturer’s instructions and...
Ngày tải lên: 10/08/2014, 22:20
... chiropractic manipulation Paraplegia 1976, 13:223-227 Kewalramani LS, Kewalramani DL, Krebs M, Saleem A: Myelopathy following cervical spine manipulation Am J Phys Med 1982, 61:165-175 10 van Zagten ... Cervical myelopathy as complication of manual therapy in a patient with a narrow cervical canal [in Dutch] Ned Tijdschr Geneeskd 1993, 137:1617-1 618 11 Dvorak J, Loustalot D, Baumgartner H, Antinnes ... M: Adverse events and manual therapy: a systematic review Man Ther 2010, 15:355-363 16 Kerry R, Taylor AJ, Mitchell J, McCarthy C: Cervical arterial dysfunction and manual therapy: a critical...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: "Sudden deterioration due to intra-tumoral hemorrhage of ependymoma of the fourth ventricle in a child during a flight: a case report" pps
... revealed an anaplastic ependymoma Our patient was seen by our pediatric oncologist for adjuvant chemotherapy Six months later, he underwent standard cranial Figure Brain magnetic resonance imaging ... Pediatrics 1992, 90:385-391 10 Federal Aviation Administration: Allowable carbon dioxide concentration in transport category airplane cabins [http:// www.airweb.faa.gov/Regulatory_and_Guidance_Library/rgNPRM.nsf/ ... tumor was soft, reddish-gray, amenable to suction and highly vascular containing a large area of hemorrhage (Figures and 3) It was almost completely resected except for a thin layer attached to...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: " Multifocal hepatoblastoma in a 6-month-old girl with trisomy 18: a case report" ppsx
... 27:203-205 Mamlok V, Nichols M, Lockhart L, Mamlok R: Trisomy 18 and hepatoblastoma Am J Med Genet 1989, 33:125-126 Tanaka K, Uemoto S, Asonuma K, Katayama T, Utsunomiya H, Akiyama Y, Sasaki MS, Ozawa ... Recognizable Patterns of Human Malformation 4th edition Philadelphia, PA: WB Saunders; 1988 Lack EE, Neave C, Vawter GF: Hepatoblastoma A clinical and pathologic study of 54 cases Am J Surg Pathol ... hepatoblastomas associated with trisomy 18 in a 3-year-old girl Pediatr Hematol Oncol 1997, 14:463-467 Maruyama K, Ikeda H, Koizumi T: Hepatoblastoma associated with trisomy 18 syndrome: A case...
Ngày tải lên: 11/08/2014, 14:20
Báo cáo y học: " Small intestinal strictures as a complication of mesenteric vessel thrombosis: two case reports" doc
... onset abdominal pain with associated nausea and vomiting She had a past medical history of a myocardial infarction, chronic obstructive pulmonary disease (COPD), transitional cell carcinoma of ... and blunt abdominal trauma [10] An ischaemic stricture of the proximal jejunum was noted in a nine-month-old baby with atypical Kawasaki disease who presented with fever and coronary artery aneurysms ... small intestine associated with acute pancreatitis Int J Pancreatol 1998, 24:237-242 Kobayashi M, Kurose K, Kobata T, Hida K, Sakamoto S, Matsubara J: Ischemic intestinal involvement in a patient...
Ngày tải lên: 11/08/2014, 14:20
Báo cáo y học: "Congenital hydrocephalus in an Egyptian baby with trisomy 18: a case report" pptx
... up and managed the patient KA also drafted the manuscript AE also managed the patient and carried out general coordination for this case report AE also drafted the manuscript, wrote its final ... 18 in Edwards's syndrome Ann Genet 1996, 39:110-112 Naguib KK, Al-Awadi SA, Moussa MA, Bastaki L, Gouda S, Redha MA, Mustafa F, Tayel SM, Abulhassan SA, Murthy DS: Trisomy 18 in Kuwait Int J ... died at the age of months due to a sudden cardiorespiratory arrest at home Discussion T18 is manifested by a variety of anatomic abnormalities involving almost all organ systems as well as life-threatening...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " Bilateral macular hemorrhage as a complication of drug-induced anemia: a case report" pps
... ruptured macro-aneurism of the retina and shaken baby syndrome Other rare causes include thrombocytopenia secondary to bone marrow aplasia, leukemia, autoimmune hemolytic anemia, aplastic anemia secondary ... Holland GN: Ocular toxoplasmosis: a global reassessment Part II: disease manifestations and management Am J Ophthalmol 2004, 137:1-17 Oner A, Ozkiris A, Dogan H, Erkilic K, Karakukcu M: Bilateral ... surgery (LASIK) Bilateral macular hemorrhages are even more uncommon, with a few reports associated with cases of head trauma, hemolytic anemia and thrombocytopenia [3] In our report, the patient...
Ngày tải lên: 11/08/2014, 19:21
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx
... AK, Khandeparkar JM, Tendolkar AG, Magotra RA, Parulkar GB: Temporary intravascular shunts for peripheral vascular trauma J Postgrad Med 1992, 38(2):68-69 Sriussadaporn S, Pak-art R: Temporary ... pseudo aneurysm: a case report Acta Orthop Scand 1998, 69:194-195 Oktar GL, Balkan ME, Akpek S, Ilqit E: Endovascular stent-graft placement for the management of a traumatic axillary artery pseudoaneurysm: ... In-theater management of vascular injury: years of the Balad Vascular Registry J Am Coll Surg 2007, 204(4):625-632 Barros D'Sa AAB, Harkin DW, Blair PHB, Hood JM, McIlrath E: The Belfast approach...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: " Gigantic retroperitoneal hematoma as a complication of anticoagulation therapy with heparin in therapeutic doses: a case report" docx
... complication such as conservative management, angiographic evaluation, percutaneous embolization or surgical intervention Case presentation A 57-year-old Caucasian male was admitted to our hospital ... creatinine kinase, lactate dehydrogenase, amylase and alkaline phosphatase were normal An electrocardiogram (ECG) revealed atrial fibrillation at a rate of 110, with nonspecific ST-segment and ... and T-wave abnormalities A radiograph of the chest showed clear lungs and slight cardiac enlargement A cardiac ultrasonographic examination showed no vegetations, intracardiac Page of (page number...
Ngày tải lên: 11/08/2014, 23:21
Case Study- A Date Class
... create an lvalue } // end function operator++ // overloaded postincrement operator; note that the dummy // integer parameter does not have a parameter name Date Date::operator++( int ) { Date ... // overloaded output operator 110 ostream &operator
Ngày tải lên: 29/09/2013, 07:20
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... GACTACTTTGGAGTTTGCGGTCAC AGTTGGGCATTCATCCATCC CAGAAAAAGACAAGGAGGAC ACAACACCACTGCTGCGGAGTTA ACATCAAGGAGCGTTAGAATCTAA GATTTAAGTGGAGCGGAATGCTA TGTGAAACGCAGTCTCTTCC CAAGGAGCGTTAGAATCTAAAG TCTCCAAACCAGATCTCTACAG ... forward forward forward reverse reverse forward reverse forward reverse Name PCR product length (bp) GTGGACGTGATGGAGGATAAG GAAGGCACGCTGAGGAAGAC GGATGAATGCCCAACTTCTCCC ACGAAACCTGGCAGAGTCCAAG GACTACTTTGGAGTTTGCGGTCAC ... each acclimation temperature was quantified (Table 3) At AT ¼ 18 °C the ratio between b mRNAa ldh a and mRNAldh a is almost : However, at AT ¼ °C the specific total mRNAldh a content decreases and...
Ngày tải lên: 19/02/2014, 02:20
The Business Case for a Healthy Workplace potx
... psychological harassment.64 The province of Saskatchewan, Canada, followed Québec’s lead three years later, and in 2007 amended their Occupational Health and Safety Act to broaden the definition of harassment ... that it cannot be assumed that all acceptable safety measures are contained in this material or that additional measures may not be required in the conditions or circumstances that are applicable ... occupational health and safety hazards (for example, chemical, musculoskeletal, electrical and machine hazards) are recognized, assessed and controlled Personal Health Resources: Personal health...
Ngày tải lên: 15/03/2014, 20:20
Case handling: a new paradigm for business process support pot
... free A1 A2 D4 A3 mandatory Skip mandatory R2 mandatory restricted mandatory D1 D2 D3 Fig Abstract example introducing the schema level of the case handling meta model mandatory for A1 , A2 and A3 ... 2000, pp 218 234 [12] Pallas Athena, Case Handling with FLOWer: Beyond Workflow, Pallas Athena BV, Apeldoorn, The Netherlands, 2002 [13] Pallas Athena, Flower User Manual, Pallas Athena BV, Apeldoorn, ... state space S based on CD is defined as the Cartesian product S = AS · DS over an activity state space AS and a data state space DS, such that • AS = A # {initial, ready, running, completed, passed,...
Ngày tải lên: 15/03/2014, 21:20
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... potential coadjuvants of those antimicrobial agents that are already available after incubation for 18 20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide at which ... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... Sigma All other chemicals were reagent grade For antimicrobial assays, the commercially available quality control strain E coli ATCC 25922 was used The bactericidal activity of Esc(1 18) against...
Ngày tải lên: 16/03/2014, 00:20
Accounting Principles - A Business Perspective, Financial Accounting (Chapters 9 – 18) A Textbook doc
... existence and amount are certain Examples include accounts payable, notes payable, interest payable, unearned delivery fees, wages payable, sales tax payable, federal excise tax payable, current ... such as accounts payable, notes payable, interest payable, unearned delivery fees, and wages payable Sales tax payable, federal excise tax payable, current portions of long-term debt, and payroll ... sale of a large item such as a refrigerator Also, a business may give a note to a supplier in exchange for merchandise to sell or to a bank or an individual for a loan Thus, a company may have...
Ngày tải lên: 28/03/2014, 21:20
Less Than Zero -The Case for a Falling Price Level in a Growing Economy (Hobart Papers) docx
... real per-capita income either stayed approximately constant (187 3 -188 0; 188 3 -188 5) or rose (188 1 -188 2; 188 6189 6), so that the average consumer appears to have been considerably better off at ... help achieve a full-information ideal for resource allocation, my argument also contradicts the claim that a variable inflation rate is the worst kind as well as the claim that an uncertain price ... falls - as it may during wartime or when a harvest fails or when a cartel manages to restrict output of some basic raw material - the unfortunate consequences, both ethical and practical, of a...
Ngày tải lên: 29/03/2014, 12:20
Báo cáo hóa học: " A case of a speech impediment following a near lightning strike" ppt
... electrical injuries and are responsible for an average of 300 injuries and 100 deaths per year in the US Lightning-related fatalities and hospitalizations are underestimated because much of the data ... case involving a similar presentation was cited by Baskerkville and McAninch in which a young female was changing an overhead light bulb in an 120 volt light fixture, which led to a low voltage ... consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Authors’...
Ngày tải lên: 20/06/2014, 22:20