camp protein kinase a pathway

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC-3¢, respectively ... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as ... 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively YEp351-SUT2 was linearized...

Ngày tải lên: 07/03/2014, 15:20

8 487 0
Tài liệu Báo cáo khoa học: Hypoxia downregulates farnesoid X receptor via a hypoxia-inducible factor-independent but p38 mitogen-activated protein kinase-dependent pathway doc

Tài liệu Báo cáo khoa học: Hypoxia downregulates farnesoid X receptor via a hypoxia-inducible factor-independent but p38 mitogen-activated protein kinase-dependent pathway doc

... [set 1, 5¢-TAGTCCAG TGTGGTGGAATTCTGC-3¢ (sense) and 5¢-AAAGCATC AGGTTCCTTCTTAAG-3¢ (antisense); set 2, 5¢-AACTTT GCTGGCCGCCGCCGCTGG-3¢ (sense) and 5¢-GGCAAC TAGAAGGCACAGTCGAGG-3¢ (anti-sense)] ... Ulrichova J, Maurel P, Pavek P & Dvorak Z (2008) SB203580, a pharmacological inhibitor of p38 MAP kinase transduction pathway activates ERK and JNK MAP kinases in primary cultures of human hepatocytes ... transactivation domain, instead, having a novel C-terminus with additional uncharacterized transactivation properties [22] Several researchers have already reported that hepatocellular hypoxia causes...

Ngày tải lên: 18/02/2014, 13:20

14 420 0
Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot

Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot

... 5¢-CAAGACGAAGACATCCCACCA-3¢, reverse 5¢-CAGATCACGTCATCGCACAACA-3¢; AP-2, forward 5¢-ATGCCGTCTCCGCCATCCCTAT-3¢, reverse 5¢-CCA GCAGGTCGGTGAACTCTT-3¢; and glyceraldehyde3-phosphate dehydrogenase (GAPDH), ... of Epac (exchange protein directly activated by cAMP) by cAMP Epac works as cAMP- sensitive guanine nucleotide exchange factor (cAMP- GEF) for the Raslike small GTPases Rap1 and Rap2 In our work, ... Master Mix (Bio-Rad), as described by the manufacturer The primers used were as follows: PAR-1, forward 5¢-CCTGCTTCAGTCTGTGC-3¢, reverse 5¢-CCAGGTGCAGCATGTACA-3¢; COL 1A1 , forward 5¢-CAAGACGAAGACATCCCACCA-3¢,...

Ngày tải lên: 30/03/2014, 04:20

11 338 0
báo cáo khoa học: " Cyclooxygenase-2 up-regulates vascular endothelial growth factor via a protein kinase C pathway in non-small cell lung cancer" pdf

báo cáo khoa học: " Cyclooxygenase-2 up-regulates vascular endothelial growth factor via a protein kinase C pathway in non-small cell lung cancer" pdf

... permeability, and the associated increase in vascular permeability may allow the extravasation of plasma proteins and formation of extracellular matrix favorable to endothelial and stromal cell migration ... Okuyama T, Ishihara S, Sato H, Rumi Ma, Kawashima K, Miyaola Y, Suetsugu H, Kazumori H, Cava CF, Kadowaki Y, Fukuda R, Kinoshita Y: Activation of prostaglandin E2-receptor EP2 and EP4 pathways ... Biotechnology (catalog number COX 229, Camarillo, CA, USA), antibody against human VEGF was obtained from Santa Cruz Biotechnology (catalog number C-1, Santa Cruz, CA, USA), and antibody against human CD34...

Ngày tải lên: 10/08/2014, 10:20

10 265 0
Insights into protein kinase a activation using cAMP analogs and amide h 2h exchange mass spectrometry

Insights into protein kinase a activation using cAMP analogs and amide h 2h exchange mass spectrometry

... R-subunits to exist as stable dimers also mediate docking to A kinase anchoring proteins(AKAPs) AKAPs act as scaffolds as well as help localize the holoenzyme to various cellular sites A variable linker ... acts as a close cAMP mimic Sp 5' Rp 3' 2' Figure 1-8 Diastereomeric Analogs of cAMP; Rp-cAMPS and Sp-cAMPS with a single sulfur substitution at the equatorial oxygen for Rp-cAMPS and at the axial ... RIα(91-244)-C The cAMP analog, Rp-cAMPS was added to a final concentration of 1mM to 50 μl of the RC sample 2.22 Sp-cAMPS bound RIα(91-244):C Sp-cAMPS is a cAMP analog and addition of the same to the...

Ngày tải lên: 16/10/2015, 15:36

0 166 0
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

... by bis-ANS was decreased upon phosphorylation A possible explanation for this apparent discrepancy could be that PKA phosphorylation induces a conformational change that increases the accessible ... The Authors Journal compilation ª 2009 FEBS C Krintel et al product obtained using the sense primer 5¢-ATC ATC TCC ATC GAC TAC TCC CTG-3¢, the antisense primer 5¢-AAG AAT TCT AGA TTA ATG GTG ATG ... Multiscan 791 CCD camera (Gatan UK, Abingdon, UK) [23] Acknowledgements We would like to thank B Danielsson and M Baum´ garten for excellent technical assistance, and R Wallen and E Hallberg (Cell and...

Ngày tải lên: 18/02/2014, 11:20

11 564 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... conserved among mammals and yeast [24,25] As protein trafficking has been very well characterized in budding yeast and is thought to involve a similar translocation mechanism as that in mammalian cells, ... Omura T (2006) Mitochondrial P450s Chem Biol Interact 163, 86–93 Bhagwat SV, Biswas G, Anandatheerthavarada HK, Addya S, Pandak W & Avadhani NG (1999) Dual targeting property of the N-terminal ... of Pennsylvania Journal compilation ª 2007 FEBS N B V Sepuri et al Boopathi E, Anandatheerthavarada HK, Bhagwat SV, Biswas G, Fang JK & Avadhani NG (2000) Accumulation of mitochondrial P450MT2,...

Ngày tải lên: 18/02/2014, 16:20

16 651 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT-3¢; ON359, 5¢-GCCGCTGGAGAAACAG CAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢ Phospho-ERK1 ... Epac and mimicked by a cAMP analogue stimulating both PKA and Epac, but not by an Epac-specific cAMP analogue [25] The differences in H89 sensitivity and possible signalling pathways involved may ... substrate was from Pierce Biotechnology (Rockford, IL, USA), and the BC assay protein quantification kit was from Uptima (Monticon, France) BAPTA-AM was from Calbiochem (La Jolla, CA, USA) Plasmids...

Ngày tải lên: 19/02/2014, 18:20

13 730 0
Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

... 48, 1922–1929 Bandyopadhyay, G., Standaert, M.L., Zhao, L., Yu B., Avignon, A. , Galloway, L., Karnam, P., Moscat, J & Farese, R.V (1997) Activation of protein kinase C (a, b, and f) by insulin ... Standaert, M.L., Galloway, L., Karnam, P., Bandyopadhyay, G., Moscat, J & Farese, R.V (1997) Protein kinase C-Z as a downstream effector of phosphatidylinositol 3 -kinase during insulin stimulation ... in the propagation of hormone and growth factor signals The recent finding that focal adhesion kinase regulates protein kinase B, glycogen synthase kinase- 3 and glycogen synthase, in an insulindependent...

Ngày tải lên: 20/02/2014, 02:21

12 593 0
Báo cáo khoa học: Inhibition of the NF-jB transcriptional activity by protein kinase A pot

Báo cáo khoa học: Inhibition of the NF-jB transcriptional activity by protein kinase A pot

... (5¢-TTTCTGGAAAGTCCCCAGGCG GAAAGTC CCTAG-3¢) The EMSA was performed as Ó FEBS 2002 PKA inhibits NF-jB transactivation (Eur J Biochem 269) 4561 Fig The effect of PKA activating agents and PKAc on NF-jB-dependent ... prooncoprotein TLS (translocated in liposarcoma) in nuclear factorkappa B p65-mediated transcription as a coactivator J Biol Chem 276, 13395–13401 19 Okamoto, T., Ogiwara, H., Hayashi, T., Mitsui, A. , ... These data indicate that PKA activation by FSK does not affect TNFa- or IL-1b-induced IjBa degradation in most cells To confirm that PKA activation does not modify DNA- p65 protein has a putative...

Ngày tải lên: 08/03/2014, 10:20

7 300 0
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

... for secondary structure evaluation, solvent accessibility calculation, angular order parameters calculation, inter-helical angle calculation, and for protein structure figure preparation Ó FEBS ... shows a significantly lower mean pKa value (5.1 ± 0.7) with large variation This may be attributed to proximity with two basic sites, the N-terminal amide and His2 Aspartic acids Asp27 and Asp30 ... highly charged surface with symmetrically arranged charged residues The charged face of RIIa D/D contains residues Asp27, Asp30, Glu34, Arg38, Arg40, Glu41, Arg43, and Arg44, of which Arg42 and Arg44...

Ngày tải lên: 08/03/2014, 22:20

12 542 0
Báo cáo Y học: The Emery–Dreifuss muscular dystrophy associated-protein emerin is phosphorylated on serine 49 by protein kinase A pptx

Báo cáo Y học: The Emery–Dreifuss muscular dystrophy associated-protein emerin is phosphorylated on serine 49 by protein kinase A pptx

... was funded by an MRC studentship and Marie Curie Fellowship awarded to RCR and Muscular Dystrophy Campaign project grants awarded to AJS-S (RA3 ⁄ 593) and JAE (RA3 ⁄ 577 and RA3 ⁄ 655) and a ... transcription-translation assays Full-length wild-type human lamin A and lamin C cDNAs in pcDNA3.1 (Stratagene) were generated [33] For the PKA assay, C-terminal His-tagged wild-type and S4 9A mutant emerin ... a grant from the Danish Natural Sciences Research Council (ONJ) ONJ is a Lundbeck Foundation Research Professor 12 13 References Nagano A, Koga R, Ogawa M, Kurano Y, Kawada J, Okada R, Hayashi...

Ngày tải lên: 17/03/2014, 17:20

14 418 0
Báo cáo Y học: Regulation of stress-activated protein kinase signaling pathways by protein phosphatases pot

Báo cáo Y học: Regulation of stress-activated protein kinase signaling pathways by protein phosphatases pot

... stress-activated protein kinase pathway by protein phosphatase 2C in mammalian cells FEBS Lett 437, 172–176 22 Takekawa, M., Adachi, M., Nakahata, A. , Nakayama, I., Itoh, F., Tsukuda, H., Taya, Y ... signals are shown MKKK, MKK kinase; MKK, MAPK kinase; MAPK, MAP kinase; TAK1, TGF-b-activated kinase 1; MEKK, MEK kinase; MLK, mixed lineage kinase; ASK1, apoptosis signal-regulating kinase 1; ... stress-responsive p38 and JNK MAPK pathways EMBO J 17, 4744–4752 21 Hanada, M., Kobayashi, T., Ohnishi, M., Ikeda, S., Wang, H., Katsura, K., Yanagawa, Y., Hiraga, A. , Kanamaru, R & Tamura, S (1998) Selective...

Ngày tải lên: 17/03/2014, 23:20

7 470 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... human human Rhesus monkey mouse Lower primer (5¢- to 3¢) CGGGAACCACTATGCC ACACAAAGCCACTGAA (V) CCCTTCTTGCCATCG (I) GCCGGTTATTTCATAGACAC (II) AAGACGTTTAGGTGCAAT (III) CCCTTTGCTGTTGGAT (IV) TGCCATGAAGATCTTAGA ... human fetal brain, human adult hippocampus, cerebral cortex and amygdala was purchased from BioChain Institute (Hayward, CA, USA) as PCR Ready First strand cDNA Total RNA from human adult brain (1.1...

Ngày tải lên: 30/03/2014, 04:20

13 347 0
Báo cáo Y học: The regulatory subunit of a cGMP-regulated protein kinase A of Trypanosoma brucei docx

Báo cáo Y học: The regulatory subunit of a cGMP-regulated protein kinase A of Trypanosoma brucei docx

... characterization of the high-affinity cAMP phosphodiesterase of Saccharomyces cerevisiae Proc Natl Acad Sci USA 83, 9303–9307 Imamura, R., Yamanaka K., Ogura, T., Hiraga, S., Fujita, N., Ishihama, A & ... coprecipitated a protein kinase activity exhibiting many characteristics of the catalytic subunit of trypanosomal PKA The coprecipitated kinase is recognized by an antibody against the bovine PKA catalytic ... mammalian PKA appears to be stimulated by cGMP rather than by cAMP [22] In the unicellular eukaryote Trypanosoma brucei, the causative agent of human sleeping sickness in Africa, cAMP signalling and...

Ngày tải lên: 31/03/2014, 23:20

10 497 0
Báo cáo y học: " Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats" pps

Báo cáo y học: " Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats" pps

... pentobarbital sodium (50 mg/kg) and placed on a heating pad The trachea was intubated to facilitate ventilation, and the femoral artery was cannulated for monitoring systemic arterial pressure (SAP) ... on 0800-2000 h, and had unrestricted access to food and water All animals were allowed to acclimatize for at least days before use Animal care and all experimental protocols applied in the present ... Santa Cruz Biotechnology, Santa Cruz, CA USA) and a rabbit anti-PKA antiserum (1:50; Santa Cruz Biotechnology) for 24 h at 4°C followed by 1-h incubation of Alexa Fluor 546-conjugated goat anti-mouse...

Ngày tải lên: 10/08/2014, 05:21

9 635 0
Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

... uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; ... PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Invitrogen (Cergy Pontoise, France) Only ... Palacios MA & Aller P (2005) Pharmacological inhibitors of extracellular signal-regulated protein kinases attenuate the apoptotic action of cisplatin in human myeloid leukemia cells via glutathione-independent...

Ngày tải lên: 23/03/2014, 06:20

13 332 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt

Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt

... could activate adenylcyclase and thus increase cellular cAMP levels and native PKA activity On the other hand, HIP/PAP via its interaction with RIIa might impair the association of PKA catalytic ... Hepatocarcinoma-intestine-pancreas/pancreatic associated protein (HIP/PAP) is expressed and secreted by proliferating ductules as well as by hepatocarcinoma and cholangiocarcinoma cells Am J Pathol ... heart PKA The sense primer (5¢-GTCGAATTCCAAGGTG AAGAACCCCAG-3¢) was located at nucleotides 63–90 of the coding sequence, and the antisense primer (5¢-TG CTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢) overlapped...

Ngày tải lên: 23/03/2014, 13:20

9 310 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

... translocated in TCDD-treated L-MAT cells We performed an nPKC translocation assay by fractionating L-MAT cells into cytosol and particulate fractions and then examining the translocation of each ... (nPKC) activation and its regulation by calcineurin activation J Biol Chem 273, 28392–28398 Altman A & Villalba M (2002) Protein kinase C-theta (PKCtheta): a key enzyme in T cell life and death ... v) CHAPS, 10–6% (v ⁄ v) Nonidet P-40 (NP-40) containing 100 lm AcDEVD–AMC (Calbiochem, San Diego, CA, USA) was added to each well Substrate cleavage to release free AMC was monitored against...

Ngày tải lên: 23/03/2014, 13:20

13 430 0
Báo cáo khoa học: Tuberous sclerosis-2 (TSC2) regulates the stability of death-associated protein kinase-1 (DAPK) through a lysosome-dependent degradation pathway doc

Báo cáo khoa học: Tuberous sclerosis-2 (TSC2) regulates the stability of death-associated protein kinase-1 (DAPK) through a lysosome-dependent degradation pathway doc

... (DRP-1, also named DAPK-2), Zipper interacting kinase (also named DAPK-3), DRAK1 (DAPK kinase- related apoptosis-inducing protein kinase 1) and DRAK2 [1] DAPK is a large 160 kDa serine ⁄ threonine protein ... Michie AM, McCaig AM, Nakagawa R & Vukovic M (2010) Death-associated protein kinase (DAPK) and signal transduction: regulation in cancer FEBS J 277, 74–80 Raval A, Tanner SM, Byrd JC, Angerman EB, ... 5¢-CAGCAGGAT TGGCTAGTTTGACTCGTCG-3¢ Autophagy Apoptosis Fig DAPK and TSC2 form a regulatory feedback loop Recent advances have established an important role for DAPK in a diverse range of signal-transduction...

Ngày tải lên: 28/03/2014, 23:20

17 368 0
w