ca2 as a signal for cell death

Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

... recovered as described above was mixed with pre-equilibrated Ni ⁄ nitrilotriacetate ⁄ agarose (Qiagen, Valencia, CA, USA), and rocked at °C for h The lysate ⁄ Ni ⁄ nitrilotriacetate bead mixture was ... another protein As only one hit was observed, this candidate was not pursued further A B cases, however, a substantial increase in PrxII pulldown was observed after cellular stimulation PrxII complexes ... not affect basal PLD1 activity or PMA-stimulated PLD1 activation, but completely ablated stimulation of PLD1 by H2O2 This shows that PrxII can function as a negative regulator of PLD1 activation...

Ngày tải lên: 20/02/2014, 01:20

9 405 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

... kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal- regulated kinase (ERK), a ... °C and lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired t-test (a ¼ 0.05) with the Bonferroni adjustment was ... endothelial cells are sufficient to initiate signal transduction [33], i.e changes in lipid dynamics in the plasma membrane can serve as a link between mechanical force and chemical signaling In fact,...

Ngày tải lên: 07/03/2014, 12:20

10 454 0
Báo cáo y học: "Intervertebral disc cells as competent phagocytes in vitro: implications for cell death in disc degeneration" pptx

Báo cáo y học: "Intervertebral disc cells as competent phagocytes in vitro: implications for cell death in disc degeneration" pptx

... peroxidase and diaminobenzadine as the substrate and enhanced with avidin-biotin complex (Vector Laboratories, Burlingame, CA, USA) Mouse IgG was used as a negative control Immunopositivity was assessed ... Methods and Protocols Edited by: Brady HJM Totowa: Humana Press Inc; 2004:207-221 Shui Y-B, Sasaki H, Pan J-H, Kojima M, Yamada Y, Hirai K-I, Takahashia N, Sasaki K: Morphological observation on cell ... expanded and passaged twice before use Two cell lines, THP-1 and J774 cells, were used as committed phagocytes whilst the fibroblast cell line, L929, was used for comparison as a nonmacrophage-like...

Ngày tải lên: 09/08/2014, 10:23

8 450 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... Hedonic ratings In the pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than...

Ngày tải lên: 03/04/2013, 21:06

10 599 1
Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study

Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study

... Our MD came across an innovation in hair care in Italy, the hair brush package was designed open so that you could feel the bristles before purchase Back at base nothing happened as our marketing ... essential part of the organization (Hedlund and Nonaka, 1993) McCartney (1998) states that `the activities that give rise to innovation are basically R McAdam Knowledge and Process Management RESEARCH ... cycles, innovation streams, and ambidextrous organisations: organisational renewal through innovation streams and strategic change In Managing Strategic Innovation and Change, Tushman ML, Anderson...

Ngày tải lên: 18/10/2013, 12:15

9 502 2
Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

... Network Load Balancing provides a greater benefit than round robin DNS entries because Network Load Balancing automatically excludes servers that are unavailable You can enhance the availability for ... Server as LAN interfaces are persistent, and the data rate is determined by the LAN technology Public network segments that appear as demand-dial interfaces are nonpersistent, and the data rate ... servers make up a proxy array called proxyarray.msft Each of the servers in the array has a unique IP address, so you need to specify an A- type resource record for each server as follows: proxyarray.msft...

Ngày tải lên: 18/10/2013, 18:15

62 360 0
Module 8: Routing as a Solution for Private Network Connectivity

Module 8: Routing as a Solution for Private Network Connectivity

... of applications that can take advantage of multicast transmissions RIP -for- IP version is an example of a protocol that can take advantage of multicast transmissions to update routing information ... information for unicast packets Unlike RIP -for- IP routers, OSPF routers maintain a map of the network in the link state database Updates to the network are reflected in the link state database ... subnets and hosts can be easily managed by RIP -for- IP version Specify auto-static routing with updates once a day at midnight To automatically update the routing information at a regular interval...

Ngày tải lên: 18/10/2013, 18:15

50 375 0
Module 10: RADIUS as a Solution for Remote Access

Module 10: RADIUS as a Solution for Remote Access

... engineers use a Web-based application for maintenance tracking and reporting Customers can place maintenance requests by using another Webbased application that either creates a maintenance request ... certificates Note As a best practice, specify RADIUS secrets that are at least 16 characters in length and that include upper case letters, lowercase letters, and punctuation 26 Module 10: RADIUS as ... Enhancing a RADIUS Design for Availability Optimizing a RADIUS Design for Performance Discussion: Enhancing the RADIUS Solution An organization has a geographically distributed work force that...

Ngày tải lên: 22/10/2013, 16:15

50 443 0
Social factors as a basis for treatment

Social factors as a basis for treatment

... increased demand for inpatient psychiatric care (Abas et al., 2003), and, while poverty and substance abuse are not necessarily related, poverty often increases the degree of harm that occurs at any ... frequency of hospitalisation (McGurk and Mueser, 2003; Sengupta et al., 1998) 167 Social factors as a basis for treatment Integration of vocational rehabilitation and mental health services Supported ... each year In 1976, Fountain House launched a national training programme and in 1988, a national expansion effort The International Center for Clubhouse Development was established in 1994, launching...

Ngày tải lên: 01/11/2013, 09:20

16 525 0
Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

... information or explanation on optimizing IP performance IP Stack IP Stack Delay and Latency IP MTU Data Data Data Data IP TCP Data Link Link Link IP TCP Data Link Header Trailer Trailer Header ... used, you can specify IP addresses based on: Classes (A, B, C) with an associated default mask Classes with variable length subnet masks (VLSM) Classless Inter-Domain Routing (CIDR) with a specified ... Internet from all locations Support for all of the hosts, as shown in the preceding diagram Support for a mission-critical Web-based application that requires 24-hoursa-day, 7-days -a- week availability...

Ngày tải lên: 21/12/2013, 05:18

58 444 0
Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

... Client an IP address and configuration information to enable IP communication The DHCP Server maintains a database that includes available and allocated IP addresses for defined subnets and the ... network traffic and IP address release As lease length Network traffic IP addresses release Increases decreases later Decreases increases sooner Note To immediately reclaim DHCP resources, you can configure ... routers for DHCP and BOOTP forwarding A mission-critical Web-based application available on a 24-hours -a- day, 7days -a- week scale No provisions exist for ensuring high availability Isolation of...

Ngày tải lên: 17/01/2014, 08:20

48 401 0
Tài liệu Module 4: DNS as a Solution for Name Resolution docx

Tài liệu Module 4: DNS as a Solution for Name Resolution docx

... databases increases as well Similarly, as the DNS zone database size increases, the length of time to resolve DNS queries increases Delegated zones divide a DNS zone database into smaller parts, ... create the subdomain for WINS under the private namespace For organizations that have the same namespace for private and public name resolution, create the subdomain for WINS at a level beneath ... zones Treated as a traditional primary zone from another BIND-based DNS server To a BIND-based DNS server, Active Directory integrated zones appear as traditional primary zones You can replicate to...

Ngày tải lên: 17/01/2014, 08:20

60 374 0
Tài liệu Learning Networks as a Means for Work Organization Development pptx

Tài liệu Learning Networks as a Means for Work Organization Development pptx

... innovations from Japan”, Organization Studies, Vol 16, No 6, pp 971-989 Nahapiet, J and Ghoshal, S (1998), “Social capital, intellectual capital and the organizational advantage”, Academy of Management ... purchases and more reliable deliveries The core company has a special VAVE team and each supplier company has a VAVE coordinator External support for the Network’s discussions, training and development ... communities are ready and willing to expand their role in an area in which they are forced in a constant search for a satisfying balance between their own scientific norms and standards and the expectations...

Ngày tải lên: 24/01/2014, 00:20

17 448 0
Tài liệu Module 5: WINS as a Solution for NetBIOS Name Resolution doc

Tài liệu Module 5: WINS as a Solution for NetBIOS Name Resolution doc

... Release, Register, Renew, Release, and Query by Unicast and Query by Unicast traffic then use Lmhosts traffic then use Lmhosts and Broadcasts and Broadcasts WINS Server Unicast reduces broadcasts ... database replication As the length of time for synchronizing redundant WINS databases increases, the probability increases that a WINS server failure will result in the use of an outdated database ... redundancy and load balancing When you use replication, all servers contain the same WINS database information Timely WINS Database Replication Highly available WINS implementation designs call for timely...

Ngày tải lên: 24/01/2014, 10:20

45 410 0
Tài liệu Module 6: NAT as a Solution for Internet Connectivity docx

Tài liệu Module 6: NAT as a Solution for Internet Connectivity docx

... Introducing NAT Designing a Functional NAT Solution Securing a NAT Solution Enhancing a NAT Design for Availability and Performance An organization has a number of sales representatives that work ... application and an inventory control application The applications are Active Directory– aware applications that store the data for the applications in a SQL Server 7.0 database How could you use NAT ... enhance availability and improve performance The following table describes how these strategies enhance availability and performance Use this strategy To enhance availability by To optimize performance...

Ngày tải lên: 24/01/2014, 10:20

34 308 0
Tài liệu Songs as a Medium for Embedded Reproductive Messages doc

Tài liệu Songs as a Medium for Embedded Reproductive Messages doc

... Chair/BNA Mercury Nashville MCA Nashville MCA Nashville Columbia Nashville Warner Bros Jason Aldean Dierks Bentley Alan Jackson Justin Moore Brad Paisley Rascal Flatts Keith Urban Brad Paisley Zac ... a content analysis of the lyrics contained in a sample of representative art songs and opera aria dating back as far as 1597 Arias are usually a melodic segment set within the context of a larger ... Band Brad Paisley Capitol Nashville/Broken Bow Dangling Rope/Capitol Records Nashville Arista Nashville/EMI Nashville Valory Music Group Arista Nashville Lyric Street Capitol Nashville Arista...

Ngày tải lên: 13/02/2014, 16:20

27 317 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... denaturant as a selective pressure to The potential for obtaining quantitative biophysical information from phage-display was suggested by a new method called alanine shotgun scanning, which analyzes...

Ngày tải lên: 19/02/2014, 12:20

7 503 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... searches for the variables containing the greatest interclass variance and the smallest intraclass variance, and constructs a linear combination of the variables to discriminate between the classes ... [14] Many parameters can be adjusted for increasing the efficiency of the algorithm The data were analysed with a window of five Fig K562 cell spectrum and spectral areas selected by genetic algorithm ... algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers selected by genetic algorithm are in shaded Ó FEBS...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... CBP coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

... C5 MTase activity in tumor cells 2-Pyrimidinone could also be considered as a mimic of an intermediate in the minor deaminative pathway of C5 MTases catalysis [6] EcoRII DNA methyltransferase ... 15 to 85 C was performed at a constant rate of 0.2 Cặmin)1 Absorbance of duplexes at 260 nm was measured using Cary 50 Bio spectrophotometer (Varian, Victoria, Australia) with temperature controller ... native PAGE; (b) incubated with 1% SDS at 65 C for and analyzed by 8% native PAGE; (c) incubated with 0.8% SDS at room temperature for 10 and analyzed by 12% SDS/PAGE (Laemmli gel) For autoradiography...

Ngày tải lên: 07/03/2014, 15:20

9 437 0
w