c the revenge of microsoft

www.it-ebooks.info .Introducing Microsoft WebMatrix ™ ® www.it-ebooks.info .www.it-ebooks.info .Introducing Microsoft WebMatrix ™ ® Laurence Moroney www.it-ebooks.info .Published with the authorization of Microsoft Corporation by: O’Reilly Media, pot

www.it-ebooks.info .Introducing Microsoft WebMatrix ™ ® www.it-ebooks.info .www.it-ebooks.info .Introducing Microsoft WebMatrix ™ ® Laurence Moroney www.it-ebooks.info .Published with the authorization of Microsoft Corporation by: O’Reilly Media, pot

... menu control, which is quickly becoming a standard with Microsoft Office and Windows user interfaces Clicking the button portion of the control performs the button’s basic action (in this case, ... Requests You can access the Requests management part of the Sites workspace either by clicking the Requests section button on the left side of the window or by clicking the Requests button on the ribbon ... http://www .microsoft. com/about/legal/en/us/IntellectualProperty/ Trademarks/EN-US.aspx are trademarks of the Microsoft group of companies All other marks are property of their respective owners The...

Ngày tải lên: 06/03/2014, 23:20

353 1,1K 0
lanczos c. the relations of homogeneous maxwell equations to theory of functions (1919)(59s)

lanczos c. the relations of homogeneous maxwell equations to theory of functions (1919)(59s)

... Lanczos calls the circle electron, which will be later rediscovered by others [14] Lanczos therefore concludes that the electron’s self-energy contribution to the action integral is not necessarily ... Lanczos stresses once again the importance of boundary surfaces in the calculation of the action integral: “ The contribution of these surfaces can in no way simply be ignored, even if the boundaries ... principles of mechanics [5] To this end he devotes Chapter to the introduction of the two basic types of monomials, that he calls vector and versor, which arise in the covariant formulation of...

Ngày tải lên: 24/04/2014, 16:48

59 433 0
The effect of inactivation for C.parvum by Pulse lamp

The effect of inactivation for C.parvum by Pulse lamp

... 1kW-MPUV Fig Inactivation effect of the lamps using the excystation method Fig Inactivation effect of the lamps using the cell culture method 3) Comparison of the evaluation methods used The experiment ... 2) Comparison of the lamps in turbid water samples The inactivation effects of the lamps on turbid water with the excystation and the cell culture methods were compared Fig shows that, concerning ... subjected to excystation culture and then observed with a microscope - Cell culture method: HCT-8 cells were used and observed with a fluorescent microscope - Mouse infection method: SCID mice...

Ngày tải lên: 05/09/2013, 09:08

4 510 0
Stringing in the Key of C#

Stringing in the Key of C#

... they were arrays of characters using either the foreach control or the index operator [] The following StringToCharAccess program demonstrates this technique: // StringToCharAccess - access the ... and continuing to the end of the string: “cd,e” (It’s the “+ 1” that skips the comma.) The Concat() function puts the two substrings back together to create “abcd,e” Control passes back up to the ... effect of removing the character(s) The logic is much simpler and less error-prone The foreach loop in the second half of the program puts the pieces back together again The output from the program...

Ngày tải lên: 04/10/2013, 21:20

24 468 0
Guide to the Secure ConfiguratGuide Configuration and Administration of Microsoft Exchange

Guide to the Secure ConfiguratGuide Configuration and Administration of Microsoft Exchange

... types of connectors available: % Site Connector The site connector uses remote procedure calls (RPCs) for serverto-server communication % X.400 Connector The X.400 connector can be used for connectivity ... as connecting to other X.400 compliant mail systems The connector complies with both the 1984 and 1988 CCITT X.400 standards % Dynamic Remote Access Service Connector – The dynamic remote access ... user account, processes initiated by the Exchange server also identify themselves by an account This account is commonly referred to as the “Exchange services account.” The Exchange Server’s access...

Ngày tải lên: 22/10/2013, 16:15

62 364 0
Tài liệu The New Generation of Microsoft Certifications: What’s at the Core? pdf

Tài liệu The New Generation of Microsoft Certifications: What’s at the Core? pdf

... • Microsoft Certified Architect: Infrastructure • Microsoft Certified Architect: Solutions In addition, there is also one product-specific architectural certification, the Messaging Architect ... and the Microsoft Certified Professional Developer (MCPD) Microsoft Certified IT Professional (MCITP) The Microsoft Certified IT Professional certification highlights specific areas of expertise ... is the first product-specific architect program under the Microsoft Certified Architect umbrella The goal for this certification is to provide the top-tier training and certification on Microsoft...

Ngày tải lên: 17/01/2014, 06:20

7 421 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... of cytochrome c and second mitochondria-derived activator of caspase (Smac ⁄ DIABLO) allows for the formation of the apoptosome, a complex that enables the activation of caspases within the cell ... in the presence of the JNK inhibitor SP600125 or in control conditions (Fig 3C) Although the presence of the inhibitor had no significant effect on cell survival or caspase activity in control cells ... stimulation activates the nuclear factor kappa-light-chainenhancer of activated B cells (NFjB) pathway, inducing expression of Mcl-1, which also blocks recruitment of Bax and Bak to the mitochondria...

Ngày tải lên: 16/02/2014, 09:20

12 721 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... sites of IC The crystal structure of IC in the complex with CPY is represented as a surface model (A) The binding interface between IC and CPY The IC residues at the buried surface in the complex ... membrane binding of IC and IC–CPY IC (bold solid lines) or IC–CPY (solid lines), the concentration of which was lM, was injected for 90 s over the surface of the L1 sensor chip coated with the phospholipid ... also the vacuolar 5378 lumens in the majority of yeast cells (70% of the cells grown at 72 h; right panels of Fig 3A,B) Therefore, the fluorescence microscopic analyses clearly demonstrate that IC–GFP...

Ngày tải lên: 19/02/2014, 05:20

10 647 1
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

... 5¢-GGACTCAAGAGAGGAACCTG-3¢; F1b, 5¢-CT GCCTTGCTCCACACCTG-3¢; F 1c, 5¢-CTGCCGTCTCC GCCGCCACT-3¢; FU, 5¢-TCAAGCCCCGCTACATAG TT-3¢; and R3, 5¢-AGGAACCAAACACCAAGTGG-3¢ (Fig 2A) Luciferase promoter ... 5¢-CCAGGCCTCTAGAATTCTGCAGTT-3¢ The synthesized primer sequence contained a codon for the Ser instead of the Met Both PCR fragments were fused at the XbaI site and subcloned into pcDNA3.1 Myc-His ... inactivated in cancer cells There may be silencer sequence speci c for cancer cells at the promoter region Such negative regulation of KLK11 expression in prostate cancer cells is compatible with the observation...

Ngày tải lên: 19/02/2014, 06:20

9 545 0
Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx

Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx

... involves conversion of UDP-glucuronate to UMP in the lumen of the vesicles and exchange of the latter with cytosolic UDPGlcNAc Once inside microsomes, the latter can, in turn, be exchanged with cytosolic ... Belgian Science Policy; and the Fonds de la Recherche ´ Scientifique Medicale CLL is a fellow of the Fonds National de la Recherche Scientifique (FNRS) References Smirnoff N (2001) l-Ascorbic acid biosynthesis ... valproate In all cases, perchloric acid extracts were centrifuged at C and the supernatants neutralized by the addition of K2CO3 These perchloric acid extracts were treated with 2% charcoal in experiments...

Ngày tải lên: 19/02/2014, 07:20

12 659 0
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

... GAT CCG TGG GCC GCA-3¢ 5¢-GAA TGA CTC GAG CCG AAG TAA TC-3¢ 5¢-CTT CTG AGG ATC CCA AAT GAC AGT-3¢ 5¢-CAT GTA AGC CCC CTC GAG TCG TTC AG-3¢ 5¢-CGT CAC GGT ATT CGA AGC C- 3¢ 5¢-CAC TGG CTA ATT CCA ... AGC C- 3¢ 5¢-CAC TGG CTA ATT CCA GTG C- 3¢ 5¢-CAC TAG CGA AGA TGC CGT C- 3¢ 5¢-CCA ACG CAG AAA CTC GGC-3¢ 5¢-CGG CAT TAT CGG TGA CAG C- 3¢ 5¢-CGC GCA ACA CTG AGG GAC-3¢ Forward Reverse Forward Reverse ... semialdehyde is then converted to succinate by the SsaDH encoded by the sad gene of pAO1 (see Fig 2) Succinate may enter the citric acid cycle, thus completing the catabolic pathway of CH3-4-aminobutyrate...

Ngày tải lên: 19/02/2014, 07:20

9 530 0
Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

... AATATACGGTTCATGGCAATACTGT CTACCCCGGCGCTGGAGTCAAC TCAGATGTTTTGCCACAAAGAGGTGCCTCCT CGA GCT TGC TTT ACA TCA GCC TGT GTC ATC TAG GGT GAA GCC GGC TTC AAG GTT ACT TCG CGG TGG GGC ACC AGC TTG TAA TGG GGC GAA TCG ... CaN CaMKII COX I COX Vb F1-ATPase b GGC TCC ATC TGC TTG TCC ATG GAA GCG GTT ACT CCA GTA TTG GAG CTG AAC GGG AAG CTC ACT GG GTG AGG GAG ATG CTC AGT GTT GG AGTAACAATTTTCAGTGCTCCAAAC AATATACGGTTCATGGCAATACTGT ... using the optimal number of PCR cycles (midpoint of the logarithmic range) This was 27 cycles (in the case of SERCA 2a), 28 cycles (CaN), 35 cycles (CaMKII) or 25 cycles (GAPDH), consisting of denaturation...

Ngày tải lên: 19/02/2014, 07:20

13 585 0
Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

... shown that the presence of the remainder of the acidic tail results in the thermodynamic stabilization of Hfq by 1.8 kcalÆmol)1 A comparison of the average electron microscopy images of HfqNter ... Firmicutes, Bacillus/clostridium group – Clope, Clostridium perfringens; Thetn, Thermoanaerobacter tengcongensis Bacillus/staphylococcus group – Bachd, Bacillus halodurans; Stau, Staphylococcus ... Amino acids characteristic of Hfq are indicated in black Amino acids in light grey are conserved in most Hfqs and located in the b-strands Acidic amino acids at the end of Hfq sequences are indicated...

Ngày tải lên: 19/02/2014, 12:20

8 428 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

... accurately the X-ray crystal structures of the equivalent complexes Therefore, the above docking protocol combined with partial knowledge of the binding site for heparin at the surface of APC ... influence of heparin on the APCcatalyzed inactivation of FVa and to confirm the specificity of the effects observed in Fig 1, time courses of FVa inactivation by wild-type APC were determined in the ... However, given the general abundance of heparin-like structures on the surface of the vascular bed, and the lack of good estimates of local concentrations of coagulation proteins or reactants during...

Ngày tải lên: 19/02/2014, 13:20

13 657 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

... also cloned the cDNA encoding rabbit fast skeletal TnI from the back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) ... 232–292), combinations of the forward and reverse primers, ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ... to actin-tropomyosin and TnC To understand the biological significance of the difference in TnI–TnC interactions, we compared the ability of TnC to neutralize the inhibitory effects of the C- terminal...

Ngày tải lên: 20/02/2014, 01:20

12 519 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

... 5¢-GGACGATGCCACCAGTGCCCTG GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and complementary primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ ... used the complementary primers 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ ... TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased from ARK/Sigma The chimeric TAP construct 1V2 was created by ligation of the 1.6 kb ScaIfragment containing the...

Ngày tải lên: 20/02/2014, 02:21

16 408 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

... that of genes CYC1 and CYC7, which encode iso-1 and iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed under aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 ... nonspeci c and toxic effects in animals To ascertain that the effects of these agents, on the catalytic activity and subunit composition of CytOX were related to their hypoxia-speci c effects, we ... expression of mRNAs for CytOX subunits and also the catalytic activity of the enzyme complex Our results show that the levels of some of the select mitochondrial and nuclear genome encoded CytOX mRNAs...

Ngày tải lên: 20/02/2014, 23:20

9 561 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid-speci c lectin was Ó FEBS 2003 A sialic acid speci c lectin from P jacquemontii (Eur J Biochem 270) ... fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions because the ... erythrocytes was marked by a 9-O-acetyl sialic acid-speci c lectin purified from the hemolymph of the snail Achatina fulica [64,66] Lectins are used for verification of the sugar specificity of the...

Ngày tải lên: 21/02/2014, 00:20

8 617 0
w