c reactive protein and risk of lung cancer

Pioglitazone use and risk of bladder cancer: An in vitro study

Pioglitazone use and risk of bladder cancer: An in vitro study

... R:caaagtagaaaagggcgacaac Rat GAPDH F:atggtgaaggtcggagtgaac R:gggtggaatcatactggaacat Cyclin D1 F:cacagtatccccagcaaatctt R:tacaaggcagaagcagcaagta p53 F:accaccatccactacaacttca R:cacaaacacgcacctcaaag Bcl-2 ... F:tctacaccgacaactccatcc R:gtgtttgcggatgatctgttt p53 F:ctcctcagcatcttatccgagt R:gctgttccgtcccagtagatta Bcl-2 F:gaggccaaatatcattctgagg R:cagtaggtcgggtgagaatagg Bax F:aagctgagcgagtgtctcaag R:caaagtagaaaagggcgacaac ... follows: ΔΔCt=(Cttarget-Ctβ-actin) control - (Cttarget-Ctβ-actin) PIO group Table 1 The sequences of PCR primers used in this study Human GAPDH F:agaaggctggggctcatttg R:aggggccatccacagtcttc Cyclin

Ngày tải lên: 15/01/2020, 20:51

10 46 0
The value of miR-155 as a biomarker for the diagnosis and prognosis of lung cancer: A systematic review with meta-analysis

The value of miR-155 as a biomarker for the diagnosis and prognosis of lung cancer: A systematic review with meta-analysis

... expression for lung cancer diagnostic accuracy, whereas 7 articles including 11 studies related to the correlation of miR-155 and lung cancer prognosis.(Fig.1) Studies characteristics and quality ... biomarker which coluld be used to screen in the early stage of lung cancer or predict clin-ical outcomes in advance to provide guidance for cancer therapy Numerous studies have indicated that microRNAs ... decrease the sensitivity of lung cancer cells to cisplatin [38] Moreover, another re-search conducted by Katrien et al found that miR-155 in-creases resistance to chemotherapy in lung cancer cells

Ngày tải lên: 17/06/2020, 19:12

10 47 0
Mammographic density and risk of breast cancer by tumor characteristics: A casecontrol study

Mammographic density and risk of breast cancer by tumor characteristics: A casecontrol study

... R C H A R T I C L E Open AccessMammographic density and risk of breast cancer by tumor characteristics: a to investigate if these associations vary by tumor characteristics and mode of detection ... postulated that the risk of screen-detected breast cancer is mostly influenced by in-herent risk, while risk of interval breast cancer is due to a combination of inherent risk and risk of masking Therefore, ... adenocarcinoma of the breast (International Classifi-cation of Diseases for Oncology codes C50.0–C50.9).Four controls were matched to each case by year ofbirth, year of entry into the MCCS and country of

Ngày tải lên: 23/07/2020, 02:37

23 15 0
A case-control study of exposure to organophosphate flame retardants and risk of thyroid cancer in women

A case-control study of exposure to organophosphate flame retardants and risk of thyroid cancer in women

... April 2017. 2 Cancer Facts & Figures 2017 https://www.cancer.org/research/cancer-facts-statistics.html Accessed 7 May 2018. 3 Lubitz CC, Kong CY, McMahon PM, Daniels GH, Chen Y, Economopoulos ... samples collected in 2010–2013 from 100 incident female, papillary thyroid cancer cases and 100 female controls of a Connecticut-based thyroid cancer case-control study We measured urinary concentrations ... the American Cancer Society grants 127509-MRSG-15-147-01-CNE (PI: Deziel), RSGM-10-038-01-CCE (PI: Zhang), the Yale Cancer Center & American Cancer Society Institutional Research Grant

Ngày tải lên: 24/07/2020, 01:31

10 31 0
Family history of prostate and colorectal cancer and risk of colorectal cancer in the Women’s health initiative

Family history of prostate and colorectal cancer and risk of colorectal cancer in the Women’s health initiative

... approach was used to estimate risk of colorectal cancer associated with a family history of prostate cancer, colorectal cancer and both cancers among first-degree relatives of all participants and ... R C H A R T I C L E Open AccessFamily history of prostate and colorectal cancer and risk of colorectal cancer in the Jennifer L Beebe-Dimmer1,2* , Cecilia Yee1, Electra Paskett3,4, Ann G Schwartz1,2, ... (aHR) and 95% confi-dence intervals (CI) for colorectal cancer associated with having a family history of colorectal cancer and/or confounders Significant baseline characteristics were included

Ngày tải lên: 06/08/2020, 03:43

10 42 0
New use of low-dose aspirin and risk of colorectal cancer by stage at diagnosis: A nested case–control study in UK general practice

New use of low-dose aspirin and risk of colorectal cancer by stage at diagnosis: A nested case–control study in UK general practice

... Stage - NCIN Data Briefing http://www.ncin.org.uk/ cancer_type_and_topic_specific_work/cancer_type_specific_work/ colorectal_cancer/ Accessed 02/08/2017. 21 Association of Coloproctology of Great ... Lanas5,6and Lucía Cea Soriano1,7 Abstract Background: Evidence from clinical trial populations suggests low-dose aspirin reduces the risk of colorectal cancer (CRC) Part of this reduction in risk ... and higher alcohol consumption were significant predictors of CRC, while none of the comorbidities evaluated showed a clear association with CRC (Table 2) Low-dose aspirin use and risk of CRC

Ngày tải lên: 06/08/2020, 03:47

11 36 0
Active smoking and risk of breast cancer in a Danish nurse cohort study

Active smoking and risk of breast cancer in a Danish nurse cohort study

... leading cause of cancer worldwide and contains over 4000 known carcinogenic substances [1] No scientific consensus has been reached on whether active tobacco smoking causes breast cancer, despite ... alcohol is an established risk factor for breast cancer, and as alcohol and smoking often come to-gether, the possible confounding by alcohol of the ef-fect of smoking on the risk of breast cancer ... References 1 International Agency for Research on Cancer (IARC) IARC Working Group on the Evaluation of Carcinogenic Risks to Humans Tobacco smoke and involuntary smoking IARC Work Gr Eval Carcinog

Ngày tải lên: 06/08/2020, 04:56

11 40 0
Mammographic breast density and risk of breast cancer in women with atypical hyperplasia: An observational cohort study from the Mayo Clinic Benign Breast Disease (BBD) cohort

Mammographic breast density and risk of breast cancer in women with atypical hyperplasia: An observational cohort study from the Mayo Clinic Benign Breast Disease (BBD) cohort

... breast cancer risk and risk prediction Breast Cancer Res 2007;9(6):217. 12 McCormack VA, dos Santos SI Breast density and parenchymal patterns as markers of breast cancer risk: a meta-analysis Cancer ... Department of Health Sciences Research, Biomedical Statistics and Informatics, Mayo Clinic, Jacksonville, FL, USA 6 Department of Medical Oncology, Division of the Women ’s Cancer Program, Mayo Clinic, ... account for the effects of age and calendar period N number of individuals, Obs observed number of breast cancer events, Exp expected number of breast cancer events, SIR standardized incidence

Ngày tải lên: 20/09/2020, 01:18

10 19 0
Use of non-steroidal anti-inflammatory drugs and risk of breast cancer: The Spanish Multi-Case-control (MCC) study

Use of non-steroidal anti-inflammatory drugs and risk of breast cancer: The Spanish Multi-Case-control (MCC) study

... cancer, includ-ing family history of breast cancer, age at menarche, and tobacco smoking Clinical-pathological characteris-tics of the breast cancers are reported in Table 2; ductal cancer accounts ... ’s characteristics (DOC 34 kb) Additional file 2: Table S2 Relationship between NSAID consumption and breast cancer according to COX2/COX1 selectivity and tumor characteristics (DOC 39 kb) Acknowledgements ... between consumption of non-steroideal anti-inflammatory drugs and breast cancer, according to tumor characteristicscontrols/cases (n) Exposed controls/cases (n) OR (95 % CI) P Acetic acid derivatives

Ngày tải lên: 20/09/2020, 15:29

11 41 0
More expression of BDNF associates with lung squamous cell carcinoma and is critical to the proliferation and invasion of lung cancer cells

More expression of BDNF associates with lung squamous cell carcinoma and is critical to the proliferation and invasion of lung cancer cells

... worldwide, and the incidence and mortality of lung can-cer are increasing every year Lung SCC and ADC are the primary histological classification of lung cancer and included in this study The outcome of ... to lung cancer therapy Keywords: BDNF, Expression, Knockdown, Lung SCC, ADC * Correspondence: labczs@mail.cmu.edu.cn 1 Center of Laboratory Technology and Experimental Medicine, China Medical ... containing exon IX was important to the higher expression in SCC cells, and BDNF was critical to the proliferation and invasion of lung cancer cells Methods Lung cancer samples 110 cases of lung

Ngày tải lên: 21/09/2020, 02:07

11 18 0
Cannabis exposure and risk of testicular cancer: A systematic review and metaanalysis

Cannabis exposure and risk of testicular cancer: A systematic review and metaanalysis

... preva-lence considerably higher in the Americas, Europe and Oceania compared to Asia and Africa [2] Testicular cancer is the most common cancer among young men, with peak incidence occurring between ... of case definition Representativeness of cases Selection of controls Definition of controls Comparability of cases and controls Ascertainment of exposure Same ascertainment for cases and controls ... Trends in testicular germ cell cancer incidence in Australia Cancer Causes Control 2008;19(10):1043 –9. 12 Huyghe E, Matsuda T, Thonneau P Increasing incidence of testicular cancer worldwide: a review

Ngày tải lên: 22/09/2020, 22:43

10 20 0
Parental occupational exposure to pesticides and risk of childhood cancer in Switzerland: A census-based cohort study

Parental occupational exposure to pesticides and risk of childhood cancer in Switzerland: A census-based cohort study

... Classification of Childhood Cancer (ICCC-3) [26] We separately investigated following outcomes: Any cancer (all cancers or all ICCC-3 diagnostic groups); leukaemia (ICCC-3 main diagnostic group ... between specific childhood cancers types and parental occupational exposure to pesticides Keywords: Childhood cancer, Pesticides, Occupation, Record-based cohort © The Author(s) 2020 Open Access This ... to chemotherapy are known to increase the risk of certain types of child-hood cancers [2, 3] Numerous environmental risk fac-tors have been suspected to contribute to the risk of childhood cancer

Ngày tải lên: 22/09/2020, 23:18

11 15 0
Lack of a protective effect of cotton dust on risk of lung cancer: Evidence from two populationbased case-control studies

Lack of a protective effect of cotton dust on risk of lung cancer: Evidence from two populationbased case-control studies

... Background Lung cancer is the leading cause of cancer death in North America, accounting for about a quarter of all cancer deaths [1,2] Due to a lack of effective screening, most cases of lung cancer ... American Cancer Society Cancer Facts & Figures 2010 Atlanta, GA: American Cancer Society; 2010. 3 Boffetta P, Trichopoulos D Cancer of the lung, larynx and pleura In: Adami HO, Hunter D, Trichopoulos ... 857 lung cancer cases in Study 1 were 41.9% squamous cell carcinoma, 18.6% small cell carcinoma, and 19.5% adenocarcinoma In Study 2, there were 1203 lung cancer cases: 29.3% squamous cell carcinoma,

Ngày tải lên: 30/09/2020, 11:20

11 13 0
Ratio of n-3/n-6 PUFAs and risk of breast cancer: A meta-analysis of 274135 adult females from 11 independent prospective studies

Ratio of n-3/n-6 PUFAs and risk of breast cancer: A meta-analysis of 274135 adult females from 11 independent prospective studies

... reference. %tFC = percentage of total Fatty Acid; GC = Gas Chromatography; LC n-3 = long chain n-3 PUFAs including EPA, DPA and DHA; NCC = prospective nested case–control study; PC = prospective cohort ... association between per 1/10 incre-ment of dietary or serum PL ratio of n-3/n-6 PUFA and BC risk, which was combined by a two-stage random-effect model Figure A indicated association of BC risk ... as indicative of heterogeneity according to Cochrane Handbook, and defined the low, moderate and high degrees of heterogeneity by I2 values of 25%, 50% and 75% as cut-off points [28] respectively

Ngày tải lên: 05/11/2020, 01:16

14 25 0
Healthy lifestyle and risk of breast cancer for indigenous and non-indigenous women in New Zealand: A case control study

Healthy lifestyle and risk of breast cancer for indigenous and non-indigenous women in New Zealand: A case control study

... activity and the risk of breast cancer WCRF/AICR systematic literature review, continuous update report Washington DC: AICR; 2008. 8 World Cancer Research Fund/American Institute for Cancer Research: ... prevention of cancer: a global perspective Washington DC: AICR; 2007. 7 World Cancer Research Fund/American Institute for Cancer Research: The associations between food, nutrition and physical activity ... Active smoking and secondhand smoke increase breast cancer risk: the report of the canadian expert panel on tobacco smoke and breast cancer risk (2009) Tob Control 2011, 20:e2 doi:10.1136/tc.2010.035931.

Ngày tải lên: 05/11/2020, 01:56

10 18 0
Alcohol consumption and risk of gastric cancer: A cohort study of men in Kaunas, Lithuania, with up to 30 years follow-up

Alcohol consumption and risk of gastric cancer: A cohort study of men in Kaunas, Lithuania, with up to 30 years follow-up

... epidemiological evidence concerning the association between alcohol drinking and gastric cancer is inconclusive Several published case–control and cohort studies on alcohol and gastric cancer have ... Trang 2Despite the declining incidence and mortality rates, gas-tric cancer represents the fourth most common incident cancer and the second most common cause of death from cancer in the world [1] ... evaluation of alcohol drinking and gastric cancer risk Keywords: Alcohol, Alcoholic beverage, Gastric cancer, Cohort studies, Risk factors * Correspondence: ruta.everatt@vuoi.lt 1 Group of Epidemiology,

Ngày tải lên: 05/11/2020, 09:15

11 15 0
red and processed meat consumption and risk of bladder cancer a dose response meta analysis of epidemiological studies

red and processed meat consumption and risk of bladder cancer a dose response meta analysis of epidemiological studies

... body of evidence concerning red and processed meat consumption and risk of bladder cancer [5 6] Results from the review by Wang et al [5] indicated an increased risk of bladder cancer of 17 and ... potentially increase the risk of bladder cancer through heterocyclic amines and polycyclic aromatic hydrocarbons, which can be generated from high temperature cooking [56] Hetero-cyclic amines and polyHetero-cyclic ... particular processed meat, is a potential risk factor for several cancers, with the most convincing evi-dence for colorectal cancer [50] In 2015, the International Agency for Research on Cancer classified

Ngày tải lên: 04/12/2022, 16:07

13 1 0
Báo cáo khoa học: "Correlation of procalcitonin and C-reactive protein to inflammation, complications, and outcome during the intensive care unit course of multiple-trauma patients" pdf

Báo cáo khoa học: "Correlation of procalcitonin and C-reactive protein to inflammation, complications, and outcome during the intensive care unit course of multiple-trauma patients" pdf

... the day of maximum concentrations of procalcitonin (PCT) and C-reactive protein (CRP) in multiple-trauma patients. Figure 2 Serum levels of procalcitonin (PCT) and C-reactive protein (CRP) in ... data collected each day for 7 days, and on days 14 and 21 of treatment in the ICU: PCT, CRP, clinical evi-dence and laboratory data of infection, microbiological find-ings, clinical suspicion of ... inflammation, the various stages of sepsis according to American College of Chest Physicians/Society of Critical Care Medicine criteria [13], and the occurrence of organ dysfunction The final data analyzed

Ngày tải lên: 12/08/2014, 23:20

10 296 0
Báo cáo y học: "High systemic levels of interleukin-10, interleukin22 and C-reactive protein in Indian patients are associated with low in vitro replication of HIV-1 subtype C viruses" docx

Báo cáo y học: "High systemic levels of interleukin-10, interleukin22 and C-reactive protein in Indian patients are associated with low in vitro replication of HIV-1 subtype C viruses" docx

... hepatocyte-stimulating factor Proc Natl Acad Sci USA 2000, 97:10144-10149 Montecucco F, Steffens S, Burger F, Pelli G, Monaco C, Mach F: C-reactive protein (CRP) induces chemokine secretion via CD11b/ICAM-1 ... Goudsmit J, Schuitemaker H, Paxton WA: Phenotypic and genotypic comparisons of CCR5- and CXCR4-tropic human immunodeficiency virus type biological clones isolated from subtype C-infected individuals ... Expanded AIDS Surveillance Definition for Adolescents and Adults [42], which classifies patients on the basis of clinical conditions associated with HIV infection and CD4+ T- lymphocyte counts Clinical

Ngày tải lên: 12/08/2014, 23:23

15 261 0
Báo cáo khoa học: "Use of plasma C-reactive protein, procalcitonin, neutrophils, macrophage migration inhibitory factor, soluble urokinase-type plasminogen activator receptor, and soluble triggering receptor expressed on myeloid cells-1 in combination to

Báo cáo khoa học: "Use of plasma C-reactive protein, procalcitonin, neutrophils, macrophage migration inhibitory factor, soluble urokinase-type plasminogen activator receptor, and soluble triggering receptor expressed on myeloid cells-1 in combination to

... diagnostic characteristics Trial registration NCT00389337 AUC = area under the receiver operating characteristic curve; CI = confidence interval; CRP = C-reactive protein; ICU = intensive care unit; ... Sensitivity and specificity of C-reactive protein (CRP), procalcitonin (PCT) and neutrophil count were computed using the predefined cutoff values of 60 mg/l, 0.25 μg/l and 7.5 × 10 9 cells/l, respectively ... sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee Ameri-can College of Chest Physicians/Society of Critical Care

Ngày tải lên: 13/08/2014, 03:20

10 281 0
w