c labelled lignin using l u 14 c phenylalanine

In Vitro Screening of Plant Resources for Extra-Nutritional Attributes in Ruminants: Nuclear and Related Methodologies pptx

In Vitro Screening of Plant Resources for Extra-Nutritional Attributes in Ruminants: Nuclear and Related Methodologies pptx

... with a mechanical stage Procedure Place freshly extracted egg suspension into a suitable culture vessel This should ideally have a large liquid surface area to allow sufficient gas exchange for ... fluid through a 1.0 mm sieve and collect filtrate Sediment filtrate for h at 4◦ C Reduce volume using a vacuum line and filter using Baermann apparatus as described for L1 culture Make the larval ... Adelaide, SA 5001; Future Farm Industries – CRC, University of Western Australia, Crawley, WA 6009, Australia Peter G Hutton School of Animal Biology, Faculty of Natural and Agricultural Sciences,...

Ngày tải lên: 15/03/2014, 04:20

252 4,5K 0
ECOLOGY OF COLD SEEP SEDIMENTS: INTERACTIONS OF FAUNA WITH FLOW, CHEMISTRY AND MICROBES potx

ECOLOGY OF COLD SEEP SEDIMENTS: INTERACTIONS OF FAUNA WITH FLOW, CHEMISTRY AND MICROBES potx

... microbial processes controlling this availability, with animal functional and numerical responses, should yield valuable insight Many ecological processes, such as animal migrations, reproduction, ... syntrophic consortia with sulphate-reducing bacteria in the Desulfosarcina/Desulfococcus and Desulfobulbu groups (Orphan et al 2002, Knittel et al 2003), although the exact nature of the interactions ... to tidal cycles Functional responses such as small-scale migration are likely because some seep taxa are clearly mobile (Figure 5) Vertical movements within the sediment column may occur, whereas...

Ngày tải lên: 15/03/2014, 19:20

46 436 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

... cell-wall structure a) Cell wall containing cellulose microfibrils, hemicellulose, pectin, lignin and soluble proteins b) Cellulose synthase enzymes are in the form of rosette complexes, which ... potential as such materials include starches, cellulose derivatives, xyloglucans, galactomannans, and chitosan Molecular structures of the polysaccharides are collected in Figure Figure The molecular ... on cellulose by virtue of specific molecular interactions with cellulose The specific interaction has been suggested to derive from structural similarity of xyloglucan chain to cellulose and concomitant...

Ngày tải lên: 18/03/2014, 02:20

89 706 1
Báo cáo khoa học: Surface-enhanced vibrational spectroscopy for probing transient interactions of proteins with biomimetic interfaces: electric field effects on structure, dynamics and function of cytochromec doc

Báo cáo khoa học: Surface-enhanced vibrational spectroscopy for probing transient interactions of proteins with biomimetic interfaces: electric field effects on structure, dynamics and function of cytochromec doc

... macromolecule [6], thereby causing structural changes within the macromolecule that may eventually affect the reaction mechanism and dynamics This may be particularly true for processes involving ... electrode potential is also one parameter that can alter the local electric field strength experienced by the bound proteins For such spectroelectrochemical applications, Au would be the metal ... potential gradient corresponding to high local electric fields Furthermore, the local electric field strength in the electrochemical systems can readily be controlled by changing various parameters...

Ngày tải lên: 22/03/2014, 16:20

9 441 0
Báo cáo khoa học: Interactions of ultraspiracle with ecdysone receptor in the transduction of ecdysone- and juvenile hormone-signaling pdf

Báo cáo khoa học: Interactions of ultraspiracle with ecdysone receptor in the transduction of ecdysone- and juvenile hormone-signaling pdf

... experiments, a hemagluttanin (HA)-tag was placed at the N-terminus of the dUSP by cloning a double-stranded oligomer of the following sequence (upper strand, 5¢-AGCTACCCATACGACGTGCCAGACTACG CATCTCTG-3¢) ... using nuclear extract from Sf9 cells The major shift-band is speci c on account of its competition with self but not with nonself unlabelled competitor The complex on the DR1 probe contains USP, ... measured using a luciferase assay kit (Promega) in a multipurpose scintillation counter (Beckman, Fullerton, CA, USA) b-galactosidase activity was measured using chlorophenol red-b-d-galactopyranoside...

Ngày tải lên: 23/03/2014, 13:20

13 414 0
Báo cáo y học: "Complex genetic association of 6q23 with autoimmune rheumatic conditions" docx

Báo cáo y học: "Complex genetic association of 6q23 with autoimmune rheumatic conditions" docx

... will hopefully lead to the identification of the primary disease-related variants, some of which may arise from low-frequency alleles Complementary functional studies should lead to a full understanding ... sequencing in a large number of patients and controls to more fully characterise the genetic structure of the region This will be followed by well-powered genetic studies in both RA and SLE that ... Genet 2007, 39 :147 7 -148 2 Lee EG, Boone DL, Chai S, Libby SL, Chien M, Lodolce JP, Ma A: κ Failure to regulate TNF-induced NF-κB and cell death responses in A20-deficient mice Science 2000, 289:2350-2354...

Ngày tải lên: 09/08/2014, 14:20

2 208 0
Interactions of viologens with conducting polymers, metal salt solutions and glucose oxidase

Interactions of viologens with conducting polymers, metal salt solutions and glucose oxidase

... with changes in the electronic structure followed by structural relaxation phenomena due to the large electron-photon couplings in these low-dimensional systems (Feldblum et al., 1982; Crecelius ... or electrochemical polymerization Electrochemical polymerization occurs with suitable monomers which are electrochemically oxidized to create active monomeric and dimeric species which react to ... biological molecule A by the viologen radical cation generated at the electrode Figure 2.5 Chemical structure of viologen with trimethoxysilyl substituents Figure 2.6 Functionalized pyrrole with...

Ngày tải lên: 16/09/2015, 17:13

223 612 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG ... CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... Spcoq7 -c Spcoq7-w Spcoq7-x Spcoq7-y Spcoq7-z Spcoq7-m Spcoq3-w Spcoq3-x Spcoq3-y Spcoq3-z Spcoq3-m cyc1-w cyc1-x cyc1-y cyc1-z cyc1-m nb2 primer CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG...

Ngày tải lên: 18/02/2014, 14:20

16 647 0
Báo cáo khoa học: The capsid protein of human immunodeficiency virus: interactions of HIV-1 capsid with host protein factors ppt

Báo cáo khoa học: The capsid protein of human immunodeficiency virus: interactions of HIV-1 capsid with host protein factors ppt

... HIV-1 replication Cyclophilin A Cyclophilin A (CyPA) is a peptidyl–prolyl cis–trans isomerase and a member of the cyclophilin (CyP) family These proteins localize to different cellular compartments ... helix (C4 ) of CA-CTD (Fig 1C) [23] Screening of small molecules, synthetic peptides and nucleic acids, which block the Gag–LysRS interaction with minimal toxicity to the host cell, is being explored ... HIV-1 infectious activity Structure 5, 139 146 44 Howard BR, Vajdos FF, Li S, Sundquist WI & Hill CP (2003) Structural insights into the catalytic mechanism of cyclophilin A Nat Struct Biol 10, 475–481...

Ngày tải lên: 07/03/2014, 00:20

10 399 0
Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx

Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx

... organic and bioorganic molecules using molecular mechanics J Comput Chem 11, 440– 467 38 Escriba PV, Alemany R, Sastre M, Olmos G & Garcı´ aSevilla JA (1996) Pharmacological modulation of immunoreactive ... qxp ⁄ flo software using the qxp mcdock+ module (1000 cycles) qxp is the molecular mechanics module in flo+ (version April03), a molecular design program (Thistlesoft, Colebrook, CT, USA) [33] ... performed using the Monte Carlo Multiple Minimum (MCMM) Search protocol with the Merck Molecular Force Field (MMFFs) Prior to submitting the ligands to the search protocol, a minimization was carried...

Ngày tải lên: 07/03/2014, 10:20

9 479 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

... Consensus Allowing one substitution Consensus Consensus Allowing one substitution Allowing one substitution Allowing two substitutions Allowing one substitution Allowing two substitutions Allowing ... under humidified conditions (P8), and AAAGACATA (P9), and their complementary sequences CATGTCTCT (P 2C) , CATGTCCTT (P 3C) , CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT ... namely, Hi_pDEDF (5¢-ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), and Hi_Nterm R (5¢-CGGGATCCCGC...

Ngày tải lên: 07/03/2014, 10:20

14 396 0
Báo cáo khoa học: Differential interactions of decorin and decorin mutants with type I and type VI collagens pptx

Báo cáo khoa học: Differential interactions of decorin and decorin mutants with type I and type VI collagens pptx

... triple complexes consisting of type VI collagen, decorin and type I collagen using surface plasmon resonance measurements KA (M)1) 6.9 1.4 1.6 1.7 VI VI VI VI collagen collagen/DCN WT collagen/DCN ... stoichiometric analysis of the surface plasmon resonance measurements revealed that a single collagen molecule binds about 0.186 decorin molecules in the presence as well as the absence of its glycosaminoglycan ... neutralization of acid soluble calf skin collagen as described previously [12] To obtain type I collagen monomers, type I collagen was methylated which shifts the isoelectric point of the molecule...

Ngày tải lên: 07/03/2014, 16:20

10 461 0
Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe pdf

Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe pdf

... monoclonal mouse anti-Ha Ig (clone 12CA5, Roche Molecular Biochemicals), and the immunocomplexes were adsorbed with protein A–agarose (Roche Molecular Biochemicals) for h at C The immunoprecipitation ... fractionated in native solution conditions by gel filtration employing a Superdex-200 HPLC column The fractions eluted from the column were subjected to SDS/ PAGE, blotted, and subsequently analyzed ... Tps1p activity in S pombe is present in the high molecular mass trehalose synthase–trehalase complex or linked to forms of lower molecular mass as for neutral trehalase, although accumulation...

Ngày tải lên: 08/03/2014, 23:20

9 431 0
Đề tài " On the periods of motives with complex multiplication and a conjecture of GrossDeligne " pdf

Đề tài " On the periods of motives with complex multiplication and a conjecture of GrossDeligne " pdf

... vector bundles We are thus reduced to proving the equality (1 − ζ l )−rk(Vl ) chµn (λ−1 (V l )) = ⊕ −ζ l c1 (V l ) − l for all l ∈ Z/n Let rl := rk(Vl ); we compute rl (−1)k ζ lk ch(Λk (V l ... The following lemma, proved in [14, Lemma 5.2, Sec 5], establishes the link between Lerch ζ-functions and Dirichlet L- functions It follows from the functional equation of Dirichlet L- functions ... Exercices de calcul int´gral , Paris, 1811 [16] M Lerch, Sur quelques formules relatives au nombre des classes, Bull Sci Math 21 (1897), prem partie, 290–304 e e [17] V Maillot and D Roessler, Conjectures...

Ngày tải lên: 14/03/2014, 22:20

29 513 0
Báo cáo khoa học: Interactions of elongation factor EF-P with the Escherichia coli ribosome doc

Báo cáo khoa học: Interactions of elongation factor EF-P with the Escherichia coli ribosome doc

... raised using nude mice This study received ethical approval by the University of Toronto Animal Care Committee, which is in full compliance with the Guidelines of the Canadian Council on Animal Care ... presence (+) or absence (–) of EF-P protein The positions of chemical attack were determined using reverse transcriptase and a 22-nucleotide cDNA primer 5¢-TCTCCAGCGCCACGGCAGATAGG GACC-3¢, complementary ... was sequentially purified first through a column of QAE–Sepharose, followed by hydroxylapatite, Sephacryl S-300 and Mono-Q columns using FLPC Fractions were assayed after each step to locate the...

Ngày tải lên: 16/03/2014, 06:20

11 363 0
Báo cáo khoa học: Interaction of the C1 complex of Complement with sulfated polysaccharide and DNA probed by single molecule fluorescence microscopy pdf

Báo cáo khoa học: Interaction of the C1 complex of Complement with sulfated polysaccharide and DNA probed by single molecule fluorescence microscopy pdf

... preincubated with lL of lM unlabeled C1 q for 45 min, then lL of labeled C1 r were added, and according to case with lL of 45 lM fucoidan Molecular combing The combing process consists in the stretching ... surface (B–D) Molecular combing of the T4 DNA after incubation with fluorescent (Alexa 488-fluorescent beads) C1 q, CLR and C1 proteins, respectively (E) Molecular combing of the T4 DNA after incubation, ... region of C1 q Discussion C1 q can bind several polyanionic molecules like sulfated polysaccharides and also DNA, but with the opposite effects of either inhibition or activation, respectively Using...

Ngày tải lên: 16/03/2014, 23:20

7 396 0
Báo cáo khóa học: The proteasome inhibitor, MG132, promotes the reprogramming of translation in C2C12 myoblasts and facilitates the association of hsp25 with the eIF4F complex pptx

Báo cáo khóa học: The proteasome inhibitor, MG132, promotes the reprogramming of translation in C2C12 myoblasts and facilitates the association of hsp25 with the eIF4F complex pptx

... eIF4E C Immunofluorescence microscopy C2 C12 cells were seeded on cm plates ( 300 000 cells per plate) Following incubation with or without SB203580 or MG132, cells were washed once in NaCl/Pi, ... IgG) conjugated to FITC (green) detected the unlabelled mAb aB-crystallin Actin was visualized with phalloidin conjugated to FITC or TRITC (pseudocoloured green or red, respectively) and nuclei with ... frozen in liquid N2 SDS/PAGE, vertical slab iso-electric focusing and immunoblotting Samples containing equal amounts of protein were resolved by SDS/PAGE or vertical slab iso-electric focusing (VSIEF)...

Ngày tải lên: 23/03/2014, 12:20

16 405 0
Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx

Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx

... Rac1 and Cdc42 and a putative regulator of cell–cell adheren junctions [39,40] According to the GST pull-down assays, the interaction took place strictly and specifically between the C- terminal ... the nucleus Rac proteins stimulate the formation of lamellipodia and membrane ruffles and are involved also in actin polymerization, cell–cell adhesion and cell motility, whereas Cdc42-activation ... accumulates at the plus ends of growing microtubules [52] The CLIP170–IQGAP1 complex appears to function as a linker between the plus ends of microtubules and cortical actin meshwork It may recruit...

Ngày tải lên: 23/03/2014, 13:20

16 334 0
Báo cáo Y học: Chimeric receptor analyses of the interactions of the ectodomains of ErbB-1 with epidermal growth factor and of those of ErbB-4 with neuregulin potx

Báo cáo Y học: Chimeric receptor analyses of the interactions of the ectodomains of ErbB-1 with epidermal growth factor and of those of ErbB-4 with neuregulin potx

... respectively) All of the chimeric receptors mentioned above were constructed by the PCR with appropriate primers, and were confirmed by DNA sequence analysis Cell lines and cell culture Chinese ... of EGFreceptor utilizing chimeric chicken/human receptor molecules EMBO J 8, 421–427 18 Lax, I., Fischer, R., Ng, C. , Segre, J., Ullrich, A., Givol, D & Schlessinger, J (1991) Noncontiguous regions ... properly evaluate the relative contributions of the extracellular domains to the cognate-ligand bindings Thus, the relative contributions of the four extracellular domains of ErbB-4 to the specific...

Ngày tải lên: 24/03/2014, 03:21

7 452 0
Báo cáo khoa học: Interactions of the peripheral subunit-binding domain of the dihydrolipoyl acetyltransferase component in the assembly of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus pot

Báo cáo khoa học: Interactions of the peripheral subunit-binding domain of the dihydrolipoyl acetyltransferase component in the assembly of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus pot

... R13 5C- ethyl R13 5C- propyl R13 5C- butyl R135M R13 5L R135K Arg135 (wt) (–CH3) (–CH2SCH3) (–CH2SCH2CH3) (–CH2SCH2CH2CH3) (–CH2SCH2CH2CH2CH3) (–CH2CH2SCH3) (–CH2CH(CH3)(CH3)) (–CH2CH2CH2CH2NH3+) (–CH2CH2CH2NH 2C( ¼ ... (reverse), 5¢-CGCGCATACTTCATCACGGAC GGCAT-3¢; R135K (forward), 5¢-GCCATGCCGTCCGT GAAGAAGTATGCGCGCGAAAAA-3¢; R135K (reverse), 5¢-TTTCGCGCGCATACTTCTTCACGGACGGCA-3¢; R13 5C (forward), 5¢-ATGCCGTCCGTGTGCAAGTA ... (calÆmol)1ÆK)1) R135A R13 5C- methyl R13 5C- ethyl R13 5C- propyl R13 5C- butyl R135M R13 5L R135K Arg135 (wt) (–CH3) (–CH2SCH3) (–CH2SCH2CH3) (–CH2SCH2CH2CH3) (–CH2SCH2CH2CH2CH3) (–CH2CH2SCH3) (–CH2CH(CH3)(CH3))...

Ngày tải lên: 30/03/2014, 20:20

9 323 0
w