c 1163 c 1230 queen of england

46595 a typical day in the life of the queen of england

46595 a typical day in the life of the queen of england

... February 2002 Educated at home Buckingham Palace (official London residence) The Palace of Holyroodhouse (official Scottish residence), Windsor Castle, Sandringham House and Balmoral Castle are also ... reads Cabinet and Foreign Office papers Receives visiting Heads of State and pays official visits to overseas countries Head of the Church of England, the Royal Navy, Army and Royal Air Force, ... of the year Married HRH Prince Philip, Duke of Edinburgh on 20 November 1947 Four children: Prince Charles (The Prince of Wales), Princess Anne (The Princess Royal), Prince Andrew (The Duke of...

Ngày tải lên: 26/08/2016, 16:04

6 491 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

... C rproErv -C CT 29 kDa 24 kDa rmErv -C CT 20 kDa M 45 30 25 20 15 10 C C B rproErv -C+ CT rproErv -C CT rmErv -C+ CT rmErv -C CT 2 Fig (A) Time course of activation to the mature form (I) rproErv -C+ CT ... determined kcat (s)1)a rproErv -C+ CT rproErv-CDCT Latex Erv -C [17] Km (lM)a kcat ⁄ Km (s)1ÆmM)1) Speci c activity at 37 °Cb (UÆmg)1) Speci c activity at 65 °Cb (UÆmg)1) IC50 against E-64 (nM )c 0.0170 ... mature catalytic domain is ˚ 1037 A2, which is  56% of the total surface area of the CT-extension The Leu side chain at the position 23 of the CT-extension occupies specificity pocket S2 of the catalytic...

Ngày tải lên: 14/02/2014, 14:20

13 761 0
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... activation of a family of cytosolic cysteine proteases, caspases, which are required for many of the morphological changes that occur during apoptosis The mitochondrial release of cytochrome c ... final concentration of 1% Extracts were incubated for 20 at C and centrifuged at 18 000 g in a microcentrifuge at C For immunoprecipitation assays, extracts of transfected cells were immunprecipitated ... transfected in HEK-293T cells led to increased caspase activity When GFP–Itch was cotransfected with tBid, caspase activity was dramatically reduced (Fig 2B, right panel, Itch) In contrast, reducing...

Ngày tải lên: 16/02/2014, 09:20

12 721 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

... specifically recognize cisplatin-damaged DNA: a clue to anticancer activity of cisplatin FASEB J 12, 791–799 30 Kasparkova J & Brabec V (1995) Recognition of DNA interstrand cross-links of cis-diamminedichloroplatinum(Ii) ... p73 DNA recognition of the protein than for its ‘activated’ forms [33] Recently, it has been reported that accessibility of the p53 CTDBS is critical for (sequence-nonspeci c) cisPtDNA recognition ... 1–68 Academic Press Inc., San Diego 28 Takahara PM, Rosenzweig AC, Frederick CA & Lippard SJ (1995) Crystal structure of double-stranded DNA containing the major adduct of the anticancer drug cisplatin...

Ngày tải lên: 19/02/2014, 05:20

14 600 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... for IC and IC–CPY IC (A) or IC–CPY (B), the final concentration of which was lM, was added to PCbased liposomes (0.5 mgÆmL)1 of PE ⁄ PC, PC, PS ⁄ PC, and PtdIns ⁄ PC) in 20 mM Hepes (pH 7.2) containing ... detectable Proteins Liposomes ka (102 d1–7IC PE ⁄ PC PC PS ⁄ PC PtdIns ⁄ PC PG ⁄ PC PtdIns(3)P ⁄ PC PtdIns(3,4)P2 ⁄ PC PtdIns(3,4,5)P3 ⁄ PC PE ⁄ PC PC PS ⁄ PC PtdIns ⁄ PC PG ⁄ PC PtdIns(3)P ⁄ PC ... cytoplasmic localization of IC in the logarithmic-phase cells Previous work on the inhibitory properties of IC in vitro, in which IC was shown to inactivate and interact with CPY under acidic...

Ngày tải lên: 19/02/2014, 05:20

10 647 1
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

... F1a, 5¢-GGACTCAAGAGAGGAACCTG-3¢; F1b, 5¢-CT GCCTTGCTCCACACCTG-3¢; F 1c, 5¢-CTGCCGTCTCC GCCGCCACT-3¢; FU, 5¢-TCAAGCCCCGCTACATAG TT-3¢; and R3, 5¢-AGGAACCAAACACCAAGTGG-3¢ (Fig 2A) Luciferase promoter ... sequence (GenBank accession number NM006853 and NM14497): R1, 5¢-ATGGTGTCTGTGATGTTGCCG-3¢ and R2, 5¢-TTCTCACACTTCTGGTGCTC-3¢ DNA sequences of the PCR products were determined using an automatic DNA ... (primers 5¢-TCATGCTGGTTGAGACTG GA-3¢ and 5¢-CCAGGTGTGGAGCAAGGCAG-3¢) and a 938 bp fragment of promoter (primers, 5¢-CTCACAG CAGCCAGTAAGTG-3¢ and 5¢-ACTCACAGGCTCTGG GGCTG-3¢) were amplified using...

Ngày tải lên: 19/02/2014, 06:20

9 545 0
Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

... Firmicutes, Bacillus/clostridium group – Clope, Clostridium perfringens; Thetn, Thermoanaerobacter tengcongensis Bacillus/staphylococcus group – Bachd, Bacillus halodurans; Stau, Staphylococcus ... role of the C- terminal domain on Hfq (Eur J Biochem 271) 1261 Fig Multiple sequence alignment of various bacterial Hfqs The alignment was produced with T-COFFEE Amino acids characteristic of Hfq ... solanacearum Proteobacteria a subdivision – Caucr, Caulobacter crescentus; Bruab, Brucella abortus; Brume, Brucella melitensis; Azoca, Azorhizobium caulinodans; Agrtm, Agrobacterium tumefaciens;...

Ngày tải lên: 19/02/2014, 12:20

8 428 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf

... ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ... RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) These primers were designed based on the sequence retrieved from the GenBank database under accession number ... biological significance of the difference in TnI–TnC interactions, we compared the ability of TnC to neutralize the inhibitory effects of the C- terminal fragments in the presence and absence of Ca2+...

Ngày tải lên: 20/02/2014, 01:20

12 519 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

... 5¢-GGACGATGCCACCAGTGCCCTG GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and complementary primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ ... 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ All primers were purchased from ARK/Sigma The chimeric TAP construct 1V2 was created by ligation of the 1.6 ... 5¢-GGATGAGGCTACCAGTGC TC TGGACGCCTAG TGCGAGCAGGC-3¢ and 5¢-GCCTGCTCGCACTAGG CGTCCAGAGCACTGGTAGCCTCATCC-3¢ All TAP constructs were transfected into T2 cells by electroporation using a Bio-Rad gene...

Ngày tải lên: 20/02/2014, 02:21

16 408 0
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

... chain factors, eukaryotic class polypeptide chain release factor (eRF1) and eukaryotic class polypeptide chain release factor (eRF3) The major functions of eRF1 include recognition of each of the ... structure and function of the eRF1 C- domain A B C E D Fig The solution structure of the C- domain (A) Stereo view of the ensemble of the final 48 calculated structures Twenty-four structures of ... gene that enhances the termination efficiency by stimulating the activity of eRF1 [1–4] eRF1 contains three structurally separated domains, each of which can be assigned a speci c function The N-terminal...

Ngày tải lên: 06/03/2014, 11:20

17 495 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

... 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E190A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E190A, 5¢-CAAATTGGGGG ... CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E199A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E204A Mutated codons ... primers 5¢-TCTCGGAGATCC GACAGA-3¢ and 5¢-CTTTCGGGCTTTGTTAGCAG-3¢, respectively CD spectra were acquired on a J-810 spectropolarimeter (Jasco, Tokyo, Japan) with an attached Peltier temperaturecontrolled...

Ngày tải lên: 07/03/2014, 04:20

14 418 0
Báo cáo khoa học: C Isotopologue editing of FMN bound to phototropin domains potx

Báo cáo khoa học: C Isotopologue editing of FMN bound to phototropin domains potx

... CCAGGTCACCCAATCATGTACGCAAGCGCTGGTTTCTTCAACATGACCGGTTACACATCCAAG ACTTACTTCCACTTGCATGCCGATGAACTTGAGGACACGACCTTCTTCATCCTTGATTGGTGCAATGG GCACTGTCCGCATTCCAACAGACCTTCGTAGTTTCGGACGCCAGCCGTCCAGGTCACCCAATCATGTACGCAAG ... GACATCGCGCTGCTCCTTGACTGCATCACGGATCAGCTGCACTGCTTTACGATCAGTACCGCGGCC CATCTTCGCGAGTGACCGGTTTCTGGAGCTCACGGAGTATACACGTGAGGAAGTCCTAGGTAACAACTGC CCAAAAGGCGCGCCCACCTTTTGTATAGTTTAAAACCTGTACAGTGACATCGCGCTGCTCCTTGACTGC AAGTCTTTCGTGATCACAGATCCTCGTTTACCAGACAACCCTATCATCTTCGCGAGTGACCGGTTTCTG ... AGTTTCTTGCAGTTGACAGAATATTCGCGAGAAGAAATTCTGGGTCGTAACTGCCGTTTTCTTCAAGGTCC CACGCTCGGCCGCATCACGGACATGTTCGGTACCATCCAACTGGACACCAATAAAGTACTGGACATC GTCATTACTGACCCACGTTTGCCAGATAATCCCATTATCTTCGCGTCCGATAGTTTCTTGCAGTTGACAGAATATTC...

Ngày tải lên: 07/03/2014, 05:20

15 263 0
Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx

Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx

... dimeric non-mutated CAC, is important in the virus cycle, as confirmed by structural studies of CAC in the presence of various molecules and agents [28–31] Results Relaxation measurements of CACW40A ... feature of the whole dimeric CAC domain Dynamics of monomeric CAC Model-free analysis versus spectral density mapping Our results indicate that the relaxation data of CACW40A could not be satisfactorily ... NMR concentration by using Centriprep Amicon devices (Millipore), with a molecular mass cut-off of 3500 Da Protein structure calculations The determination of the solvent-accessible surface area...

Ngày tải lên: 07/03/2014, 06:20

13 421 0
Báo cáo khoa học: The variable C-terminal extension of G-protein-coupled receptor kinase 6 constitutes an accessorial autoregulatory domain ppt

Báo cáo khoa học: The variable C-terminal extension of G-protein-coupled receptor kinase 6 constitutes an accessorial autoregulatory domain ppt

... La Jolla, CA) (18 cycles: 94 C for min, 55 C for min, 72 C for min, followed by a single incubation at 72 C for 10 min) using primer P1, 5¢-CGCCA AGATTCCTCTGGGAACTCCAGCGACAGT-3¢ (nucleotides ... is catalytically inactive and specifically present in the nucleus of transfected COS-7 cells In contrast, all three forms carrying a complete catalytical domain are catalytically active and localized ... mGRK6-A cDNA by PCR (30 cycles: 94 C for min, 70 C or 62 for min, 72 C for min, followed by a single incubation at 72 C for 10 min) using primer P1, 5¢-AGCCCATGGAGCTCGAGAACA TCGTA-3¢ (nucleotides...

Ngày tải lên: 07/03/2014, 12:20

13 425 0
Báo cáo khoa học: Ligand-specific dose–response of heterologously expressed olfactory receptors potx

Báo cáo khoa học: Ligand-specific dose–response of heterologously expressed olfactory receptors potx

... 5-ATggAgCAgAAACTC ATCTCTgAA-3¢ and 5¢-TTCTgCAgCTAACCAATTTTg CTgCCTTTgTT-3¢ for I7, 5-CgggATCCATgCAgCCA gAATCTggggCC-3¢ and 5¢-CCgCTCgAgTCAAgCCAg TgACCgCCTCCC-3¢ for OR17-40 Each PCR consisted of 40 cycles: ... engineering chimeric constructs with only part of the coding sequences of olfactory receptors [3,24] Only the c- myc tag was added at the 5¢-terminus of I7 sequence Olfactory receptor speci c and dose-dependent ... ODORA cells, only 1& of the cells yielded a discrete punctuate labeling at the level of the plasmic membrane (Fig 2C) Intracellular calcium assay Characteristics of the calcium response to odorant...

Ngày tải lên: 08/03/2014, 02:21

8 315 0
C++?? A Critique of C++ and Programming and Language pot

C++?? A Critique of C++ and Programming and Language pot

... static type checks can reject a class of programs that are otherwise type valid List classes are an example of where static type checking can reject a valid program A list class can contain objects ... impede the production of such sophisticated systems C+ + Specific Criticisms 3.1 Virtual Functions This is the most complicated section in the critique, due to C+ +’s complex mechanisms Although ... functions on a class: i: INTEGER ch: CHARACTER © Ian Joyner 1996 C+ +?? 24 i := ch.ord // i becomes the integer value of the character ch := i.char // ch becomes the character corresponding to...

Ngày tải lên: 08/03/2014, 23:20

63 515 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

... MALDI-TOF-TOF mass spectrometry A selection of mass spectra illustrates how the comparison of chymotryptic peptides from different cross-linked complexes and protein controls allows the detection of ... binding of Ssa1p in the vicinity of this stretch interferes with Ure2p assembly into fibrils either because of a change in the conformation of this stretch or the crowding of a surface interface involved ... MS Covalent cross-linking approaches allow: (a) the identification of surface areas involved in protein-protein interactions within protein complexes; (b) the characterization of the distance constraints...

Ngày tải lên: 15/03/2014, 00:20

12 514 0
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

... (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi of [c- 32P]ATP (3000 CiÆmmol)1; GE Healthcare) and 100 units of T4 polynucleotide kinase (New England Biolabs Inc., ... amplification of a 70 bp PCR product with [5¢-32P]-labeled S70ds ⁄ UP (5¢-AATTGATCCCGCCCGCCTC-3¢) and S70ds ⁄ DN (5¢-GCCCCG CAGCGGCGCCATGTT-3¢) primers For PCR, we added 2.5 · 10)3 pmol of primer ... of primers were designed to amplify the 5¢ and 3¢ sections of the IEP, respectively: a 5¢ end primer mut UP (5¢-GTCAGCGGTGCTGGAAG TATG-3¢) and a 3¢ end primer A400V ⁄ DN (5¢-ATTTT CCCGCACCAGCTTTCGCAAGA-3¢)...

Ngày tải lên: 15/03/2014, 09:20

11 399 0
Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot

Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot

... nuclear translocation of the intracellular C- terminal domain (ICD) of the APP family of proteins Biochemistry 42, 6664–6673 Cao X & Sudhof TC (2001) A transcriptionally [correction of transcriptively] ... antiserum C8 , which recognizes the C- terminus of APP, and the polyclonal antiserum D2-II, which recognizes the ectodomain of APLP2 (Calbiochem, EMD Chemicals Inc., Gibbstown, NJ, USA), have been described ... levels of soluble APP remaining constant irrespective of the presence or absence of BACE1 The levels of APPsa increased to account for the loss of APPsb (soluble C- terminally truncated b-cleaved...

Ngày tải lên: 15/03/2014, 10:20

16 556 0
Báo cáo khoa học: Heme oxygenase-1 ⁄p21WAF1 mediates peroxisome proliferator-activated receptor-c signaling inhibition of proliferation of rat pulmonary artery smooth muscle cells pot

Báo cáo khoa học: Heme oxygenase-1 ⁄p21WAF1 mediates peroxisome proliferator-activated receptor-c signaling inhibition of proliferation of rat pulmonary artery smooth muscle cells pot

... of cell cycle protein complexes consisting of two key regulatory molecules: CDKs and cyclins [17,24] A CDK molecule is activated by association with a cyclin, forming a CDK complex CDKs are constitutively ... stimulation, cells exit the G1 ⁄ G0 phase and start to divide [16] Cell cycle progression is precisely controlled by the activity of a series of cyclindependent kinases (CDKs), which are activated by cyclin ... expressed in cells, whereas cyclins are synthesized at speci c stages of the cell cycle [25] The expression of a cyclin is regulated at the transcriptional and degradation level to influence CDK activity...

Ngày tải lên: 15/03/2014, 10:20

8 334 0
w