... Hoechst 33258 staining for apoptotic 3T3-L1 adipocytes Scale bar: 50 lm Hoechst, stained with Hoechst 33258; B field, bright field (D) Troglitazone-induced 3T3-L1 adipocyte apoptosis 3T3-L1 adipocytes ... EB staining (E) Pioglitazone-induced 3T3-L1 adipocyte apoptosis mea-sured by Hoechst 33258 staining (hoechst) (F) PGJ2-induced 3T3-L1 adipocyte apopto-sis 3T3-L1 adipocytes were treated with 10 ... AATCGTGCGTGACATCAAAG-3¢; actin reverse, 5¢-TG TAGTTTCATGGATGCCACAG-3¢; Akt-1 forward, 5¢-A ACGGACTTCGGGCTGTG-3¢; Akt-1 reverse, 5¢-TTGTC CTCCAGCACCTCAGG-3¢; CD36 forward, 5¢-TCCAGC CAATGCCTTTGC-3¢; CD36 reverse,...
Ngày tải lên: 16/02/2014, 09:20
... D2 ) (d3 , D3 ) theo ma trận con: d D d D s22 u h22 u s u h33 u 1 , Md3 D3 = − √ 33 (17) Md2 D2 = − √ sd ω hD ω sd ω h D ω 22 22 33 33 Các quark tỷ lệ với u1 , d2 , d3 có khối ... d2 , d3 , D2 , D3 ): d d d D D h v h2 v h3 v s2 v s3 v sd u s d u s d u h D u h D u 21 22 23 22 23 d Mdown = − √ s31 u sd u sd u hD u hD u (15) 32 33 32 33 2 d ... −uαL , DαL )T ∼ (3, 3∗ , 0), (1) uaR ∼ (3, 1, 2/3) , daR ∼ (3, 1, −1/3) , UR ∼ (3, 1, 2/3) , DαR ∼ (3, 1, −1/3) Trong α = 2, số lượng tử ngoặc đơn tuân theo đối xứng (SU(3)C , SU(3)L , U(1)X )...
Ngày tải lên: 03/04/2014, 12:22
Pro C# 2008 and the .NET 3.5 Platform, Fourth Edition phần 3 ppsx
... carArray[0] = new Car("Rusty", 30); carArray[1] = new Car("Clunker", 55); carArray[2] = new Car("Zippy", 30); carArray[3] = new Car("Fred", 30); } } Ideally, it would ... carArray[0] = new Car("FeeFee", 200, 0); carArray[1] = new Car("Clunker", 90, 0); carArray[2] = new Car("Zippy", 30, 0); carArray[3] = new Car("Fred", 30, 0); Once you ... within your Program type: // I'll draw anyone supporting IDraw3D. static void DrawIn3D(IDraw3D itf3d) Trang 29static void Main(){ Console.WriteLine("***** Fun with Interfaces *****\n"); Shape[]...
Ngày tải lên: 12/08/2014, 23:20
Pro C# 2008 and the .NET 3.5 Platform, Fourth Edition phần 6 docx
... console program (named SimpleFileIO) will persist thestring data into a new file on the C drive (and read it into memory) with minimal fuss: "Fix bathroom sink", "Call Dave", "Call ... "Call Dave", "Call Mom and Dad", "Play Xbox 360"}; // Write out all data to file on C drive. File.WriteAllLines(@"C:\tasks.txt", myTasks); // Read it all back and print ... writer.WriteLine("Don't forget Mother's Day this year "); writer.WriteLine("Don't forget Father's Day this year "); writer.WriteLine("Don't forget these numbers:"); for(int...
Ngày tải lên: 12/08/2014, 23:20
Pro C# 2008 and the .NET 3.5 Platform, Fourth Edition phần 7 ppsx
... dr = new DataRelation("CustomerOrder", autoLotDS.Tables["Customers"].Columns["CustID"],autoLotDS.Tables["Orders"].Columns["CustID"]); autoLotDS.Relations.Add(dr); ... object.dr = new DataRelation("InventoryOrder", autoLotDS.Tables["Inventory"].Columns["CarID"],autoLotDS.Tables["Orders"].Columns["CarID"]); autoLotDS.Relations.Add(dr); ... autoLotDS.Tables["Customers"].Select( string.Format("CustID = {0}", custID)); strOrderInfo += string.Format("Customer {0}: {1} {2}\n", drsCust[0]["CustID"].ToString(),drsCust[0]["FirstName"].ToString().Trim(),drsCust[0]["LastName"].ToString().Trim());...
Ngày tải lên: 12/08/2014, 23:20
Pro C# 2008 and the .NET 3.5 Platform, Fourth Edition phần 8 ppsx
... details): ee -e bo o ks - Microsoft XBox 360 Sony Playstation 3 Nintendo Wii Sony PSP Nintendo DS w w w fr Conversely, if you really wanted to, you could programmatically populate an ItemsControlderived ... perform other GUI-centric programming tasks In addition, a separate API named GDI+ (bundled within the System.Drawing.dll assembly) provides additional types that allow programmers to generate ... well with the release of NET 3.5, and will exist within the base class library for quite some time (arguably forever, in fact) However, since the release of NET 3.0, Microsoft shipped a brand...
Ngày tải lên: 12/08/2014, 23:20
Pro C# 2008 and the .NET 3.5 Platform, Fourth Edition phần 9 doc
... Car(40, "BMW", "Black", "Sidd")); Add(new Car(55, "VW", "Black", "Mary")); Add(new Car(100, "Ford", "Tan", "Mel")); Add(new ... collection" Margin="10" /> <Button Name="btnOK" Content="OK" Width="80" Height="25" Margin="10" IsDefault="True" TabIndex="1" ... Click="btnOK_Click"/> <Button Name="btnCancel" Content="Cancel" Width="80" Height="25" Margin="10" IsCancel="True" TabIndex="2"/>...
Ngày tải lên: 12/08/2014, 23:20
Pro C# 2008 and the .NET 3.5 Platform, Fourth Edition phần 10 ppsx
... BorderStyle="Solid" CellSpacing="1" Font-Names="Verdana" Font-Size="9pt" ForeColor="Black" Height="250px" NextPrevFormat="ShortMonth" Width="330px" ... id="form1" runat="server"> <asp:Panel ID="Panel1" runat="server" Height="83px" Width="296px"> <asp:TextBox ID="txtRequiredData" ... MS_POSITIONING="GridLayout"> <form id="Form2" method="post" runat="server"> <asp:Button id="Button1" runat="server" Text="Button" style="Z-INDEX:...
Ngày tải lên: 12/08/2014, 23:20
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 3 potx
... See Chapter 3 f or more info The last thing you need to do with tweetPicker is release our reference to it - another memory thing We’ll come back to the memory management in Chapter 3, we promise ... At all Ever. Trang 7you are here 4 83iPhone app patterns iPhonecross Flex your vocab skills with this crossword Untitled Puzzle Header Info 1Header Info 2 3 This typically handles the information ... relationship on solid ground Trang 13this is a new chapter 89I know these are letters and all, but I have no idea what you’re saying objective-c for the iPhone 3 Twitter needs variety We did a...
Ngày tải lên: 14/08/2014, 20:21
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 4 doc
... placeholder text Navigation title bars Table view Labels Keyboard UIScrollView you are here 4 133 sam needs two views iPhone UI Design Magnets Solution Using the components shown below, lay out ... This chapter is about multiple-view apps What views would you need to have for a bartending app? 132 Chapter multiple views iPhone UI Design Magnets Using the components shown below, lay out the ... see in your Mail and Contact apps Only we’re going to it with a twist this is a new chapter 131 mix it up Look, I don’t have time for posting to Twitter I need to know a ton of drink recipes...
Ngày tải lên: 14/08/2014, 20:21
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 5 docx
... dismissModalViewControllerAnimated:YES]; } AddDrinkViewController.m Now, to see if those buttons work you are here 4 233 your modal view works Test Drive The modal view can be dismissed now, and the keyboard works ... UINavigationController *addNavCon = [[UINavigationController alloc] initWithRootViewController:addDrinkVC]; 230 Chapter plists and modal views Add this! oller just like the Allocate the AddDrinkViewContr ... controller and your buttons have a home Now we just need to create those buttons you are here 4 231 creating ui controls in code Create the save and cancel buttons Since both the save and cancel...
Ngày tải lên: 14/08/2014, 20:21
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 6 ppsx
... NSNotificationCenter named UIKeyboardDidShowNotification is triggered 3 [registeredObject keyboardDidShow:eventInfo]; Trang 13Then unregister when you’re doneJust like memory management, we need ... magnets? A: A great reference for the code samples and information for programming apps in general is the iPhone Application Programming Guide that is available on the Apple developer website ... it’s commented out by default Go ahead and uncomment it and add the code to unregister for events 3 Add a BOOL to AddDrinkViewController that keeps track of whether the keyboard is visible or not....
Ngày tải lên: 14/08/2014, 20:21
Linux Socket Programming by Example PHẦN 4 ppt
... Socket Programming by Example - Warren W Gay 192 17: 18: 19: 20: 21: 22: 23: 24: 25: 26: 27: 28: 29: 30 : 31 : 32 : 33 : 34 : 35 : 36 : 37 : 38 : 39 : 40: 41: 42: 43: 44: 45: 46: 47: 48: 49: 50: 51: 52: 53: ... Linux Socket Programming by Example - Warren W Gay 171 10: 11: 12: 13: 14: 15: 16: 17: 18: 19: 20: 21: 22: 23: 24: 25: 26: 27: 28: 29: 30 : 31 : 32 : 33 : 34 : 35 : 36 : 37 : 38 : 39 : #include ... ( !(sp = getservent()) ) Linux Socket Programming by Example - Warren W Gay 165 21: 22: 23: 24: 25: 26: 27: 28: 29: 30 : 31 : 32 : 33 : 34 : 35 : 36 : 37 : 38 : 39 : 40: 41: 42: } break; } printf("%s:\n"...
Ngày tải lên: 12/08/2014, 21:20
An action research on the use of continuous feedback to improve the first year students' pronunciation at the english department, college of foreign languages, vietnam national university, hanoi part 2
... it should not be treated as a major cause for the impossibility of generalization 3. 3 Background of the study 3. 3.1 Participants The participants of the research were selected on the basis of cluster ... could not be proper participants of the research program due to 35 their lack of participation in the very initial steps of it In addition, as the program was conducted extensively during the first ... news was the students were willing and determined to improve these weak skills 3. 3.2 The speaking and pronunciation programs A semester at the English Department lasted 15 weeks Four periods per...
Ngày tải lên: 07/11/2012, 14:58
AN ACTION RESEARCH ON THE APPLICATION OF COOPERATIVE LEARNING TO TEACHING SPEAKING TO THE SECOND YEAR SUDENTS AT THE DEPARTMENT OF ENGLISH, GIA LAI TEACHERS' TRAINING COLLEGE
... regards to the successes of CL implementing programs by thousands of teachers from many countries all over the world, I would like to carry out such a program in my department with a view to experiment ... give students any sort of meaningful practice in producing spoken English? (Brown and Yule 19 83: 3) Brown and Yule also draw a useful distinction between two basic language functions These are ... and interest, …etc.) PART 2: Role play 3 – minutes Now, I am going to give each of you a card on which there is a situation Role play the situation PART 3: general conversation based on the topic...
Ngày tải lên: 29/01/2014, 10:58
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc
... Oligonucleotides used in this study Oligonucleotide Sequence (5¢ ) 3 ) Use SecPr-5 SecPr -3 viuB-5 viuB -3 desA-5 desA -3 desD-5 desD -3 Pf GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC ... wild-type Prototrophic wild-type SCP1–, SCP2– Hopwood et al [32 ] Hopwood et al [32 ] Gunter et al [16] Bentley et al [ 13] necessary S lividans 132 6 was used as a host for Streptomyces plasmid constructions ... followed by 94 °C for min; amplification, 30 to 40 cycles of 96 °C for 30 s, 55 °C to 67 °C (depending on the set of primers used) for 30 s, and 72 °C for 30 s to 1.5 Primers (19–24-mers) (Table...
Ngày tải lên: 16/03/2014, 11:20