but apis and websites have a lot in common

... involved in inflammatory response, metabolic disease, cardiovascular disease, hematological disease and organ-ism injury and abnormalities (Table2) According to ca-nonical pathway analysis, five related ... carcinoma, adenoca adenocarcinoma Trang 8ovarian cancer [22,23] It is frequently detected in ova-rian serous carcinomas, and is also a prognostic marker in ovarian cancer patients [22] It has ... linking the two blood coagula-tion pathways The assay was conducted according to man-ufacturer’s manual In brief, all reagents, samples and standards were prepared as instructed EVs were extracted

Ngày tải lên: 17/06/2020, 18:27

... GCTTCGGAGAGTTCTGGGATTG GCAGCAAACCGCTTGGGATTA 134 bp SMAD2 CCGACACACCGAGATCCTAAC AGGAGGTGGCGTTTCTGGAAT 127 bp ACAN GCCTGCGCTCCAATGACT ATGGAACACGATGCCTTTCAC 104 bp COL2A1 CACGTACACTGCCCTGAAGGA CGATAACAGTCTTGCCCCACTT ... -induced pSMAD1/5/9 was comparable between ad-SMAD4 and ad-LacZ (Fig. 3d) Taken together, these data demonstrate that activation of the SMAD2/3 and SMAD1/5/9 signaling path-ways by TGFβ was affected ... degeneration Since SMAD2, SMAD3 and SMAD4 have been shown to differentially regulate TGFβ signaling and to have distinct functions during in vivo cartilage development and maintenance, we investigated

Ngày tải lên: 04/12/2022, 16:28

... common among them are the intelligence and warning cycles; the agencies of the IC and their collection and operational ca-pabilities; the analytic and coordination process; the products available and ... issues as the acceptable scope and reach of US intelligence gathering activities and how that informa-tion can or should be used in informing the US nainforma-tional security decision-making process ... hardcopy and softcopy, and in classifications ranging from Unclassified to Top Secret The ODNI and the organizations that comprise the IC also offer policymakers orientation briefings on a range

Ngày tải lên: 13/02/2017, 12:06

... data collection Trang 16Chapter 5: Analysis and result presents analysis procedures of collected data and the results Main analyses are descriptive analysis, exploratory factor analysis, reliability ... to measure perception The initial instrument was refined, condensed, and validated through Trang 29several stages of data analysis The attributes were factor analyzed and ultimately grouped into ... service quality, and then principally from Parasuraman et al.'s (1985) exploratory research in this area The underlying theory for Parasuraman, et al.'s (1985) measure of service quality was based

Ngày tải lên: 11/03/2017, 11:59

... problems and resolving complaints quickly, and less expensively than face to face contact Indeed, it appears that customers now expect and demand telephone and internet access to banks 24 hours a day ... considered A high standard deviation showed that the data was widely spread (less reliable) and a low standard deviation showed that the data was clustered closely around the mean (more reliable) As ... service quality: customers achieving a desired outcome, Trang 14ensuring a prompt response and appropriate service time, and training and managing service consultants so that they are knowledgeable,

Ngày tải lên: 09/04/2017, 10:32

... Chichinnya in Bole, Piassa on the way from Mohamud Music Shop to Tayitu hotel in Arada, Shola Gebeya in Yeka, Sebategna in Mercato area, and Dem Sefer in Akaki Kaliti sub-cities are among the focal ... remained a largely invisible, inadequately served and marginalized population The main challenges sex workers faced include health risks, violence and obstacles to gaining access to substantial ... selecting sites and participants in many qualitative researches that the number of sites and participants vary in accordance with specific qualitative research approaches For instance, Narrative

Ngày tải lên: 14/08/2017, 16:47

... life Also, in a study on ethics institutionalization and the quality of work life, Marta et al (2013) compare American and Thai marketing managers and find that Thai businesses organizations have ... make sure the sufficient application in the oil and gas industry Accordingly, the research design was separated into two phases: the pilot test as a qualitative research and the main survey as ... the variables related and grouped based on intervariable correlation) Continously, Confirmatory Factor Analysis (CFA) extracted from EFA was examined the measurement models and Structural Equation

Ngày tải lên: 28/10/2019, 00:46

... Tax policy changes mean that abolish some existing tax policy in the tax system These changes may withdraw old tax from taxation; add new tax to taxation, increase tax rates, decrease tax rates ... Lanka has increased by 4.2% of GDP in 2016 Expansion in financial service, insurance, telecommunications, transportation and whole sale and retail trade is the major reason for this greatest achievement ... 0.2 to 0.3 percentage point differences in growth rates in response to a major tax reform Margareta and Asa (2012) pointed that there are several ways to collect and increase tax revenue of the

Ngày tải lên: 16/01/2020, 17:52

... (Nagarajah, 2016) Artificial Intelligence can be integrated into accounting processes and thereby replace humans In fact, an artificial agent called Amelia has already started at Shell and Baker ... Definitions The accountant An accountant is a qualified person who is trained in bookkeeping and in preparation, auditing and analysis of accounts Accountants prepare annual reports and financial ... International Accounting Standards Boards (IASB) to guide and harmonize the accounting practices The IASB develops and approves International Financial Reporting Standards (IFRS), a set of international

Ngày tải lên: 26/04/2020, 21:48

... merits of action research, including bridging the gap between theory and practice and making practical improvement and positive changes in teaching and learning, some scholars have also pointed out ... computer-assisted feedback can bring about a vast array of advantages In a research article named ―Effective interpreter feedback and instruction using GoREACT”, Smith and Harris (2014) pointed ... research design, answering how the data was collected and analyzed Chapter 4 – Data Analysis, Findings and Discussion - presents the main findings of the research accompanied by the researcher‘s

Ngày tải lên: 26/08/2020, 23:06

... reading differs from extensive reading in various aspects such as reading purposes and reading materials Richards and Renandya (2002) have addressed that intensive reading refers to reading a ... EFL; secondary; Japan Increase in reading strategies & motivation Horst 2005 ESL; adults; Canada Increase vocabulary Kusanagi 2004 EFL; adults; Japan Increase in reading rate Takase 2003 EFL; ... them at any stages Teachers are responsible for providing the guidelines for collecting reading materials and analyzing the text, facilitating students’ performance in class sharing and marking

Ngày tải lên: 16/03/2021, 09:34

... reading differs from extensive reading in various aspects such as reading purposes and reading materials Richards and Renandya (2002) have addressed that intensive reading refers to reading a ... EFL; secondary; Japan Increase in reading strategies & motivation Horst 2005 ESL; adults; Canada Increase vocabulary Kusanagi 2004 EFL; adults; Japan Increase in reading rate Takase 2003 EFL; ... them at any stages Teachers are responsible for providing the guidelines for collecting reading materials and analyzing the text, facilitating students’ performance in class sharing and marking

Ngày tải lên: 19/07/2021, 11:16

... map a high road to economic and ethical performance and to mount guardrails to keep corporate wayfarers on track” Goodman and Dean (as cited in Sims, 1991) define an institutionalized act as a ... managers in Italy.Research by Al Muftah and Lafi (2011) highlights the significant relationship between physical, psychological, and social factors in the petroleum industry in Qatar and quality ... perceptions of institutionalized ethics and quality of work life between Thai and American marketing managers, revealing that Thai managers experience a greater impact from institutionalized ethics

Ngày tải lên: 15/07/2022, 20:39

... satisfactionandmotivationofemployees.Acc1 ordingtoEfraty,SirgyandClaiborne( 1 9 9 1 ) , highqualityofworkliferesultsinan increaseinjobsatisfactionandperformanceofemployees,andatthesametime,causea decreaseinbothalienationa n d t ... key factor in enhancing job satisfaction, explicit institutionalization does not have the same effect.VitellandSinghapakdi(2008)findthatexplicitandimplicitethicsinstitution alizationisassociatedwithorganizationalcommitment,jobsatisfactionandt ... o n a l i z a t i o n o f e t h i csa s “ a c t i o n s needed tomap ahighroad toeconomicand ethicalperformanceand tomountguardrailstokeepcorporatewayfarersontrack”.GoodmanandDean(ascitedinSims,1991)referredaninstitutionalizedactas

Ngày tải lên: 22/10/2022, 14:56

... Also, in a study on ethics institutionalization and the quality of work life, Marta et al (2013) compare American and Thai marketing managers and find that Thai businesses organizations have a higher ... compared to North America and European countries (Bagtasos, 2011; Wyatt & Wah, 2001) Looking back at Vietnam, Vietnam is also a country in Asia, Vietnam is also developing oil and gas industry, ... quality of work life and employees’ job Trang 25performance (Shaw, as cited in Torlak et al., 2014) Besides, acting in accordance with ethical values and policies in an organization, and creating

Ngày tải lên: 23/10/2022, 23:57

... Also, in a study on ethics institutionalization and the quality of work life, Marta et al (2013) compare American and Thai marketing managers and find that Thai businesses organizations have a higher ... compared to North America and European countries (Bagtasos, 2011; Wyatt & Wah, 2001) Looking back at Vietnam, Vietnam is also a country in Asia, Vietnam is also developing oil and gas industry, ... quality of work life and employees’ job Trang 25performance (Shaw, as cited in Torlak et al., 2014) Besides, acting in accordance with ethical values and policies in an organization, and creating

Ngày tải lên: 24/10/2022, 00:29

... direct taxation was limited to times of national emergency, generally war The principal direct tax was the land tax, originally a tax on real and personal property and incomes20 but it became a tax ... taxation, and the mechanics of assessment and collection, demanded and engendered a close and continuous relationship between the state and the taxpayer This made taxation a highly visible and ... cotton manufacturing industries all grew rapidly, and the development of the railways was astonishing, all stimulated by an expansion in markets and available labour resulting from a trebling of...

Ngày tải lên: 18/02/2014, 11:20

... standards as Singapore (at the time of its registration as a new car in Singapore) Fuel Economy Labelling Scheme (FELS) All cars and light goods vehicles are required to have CO2 (in g/km) and ... Open Market Value (OMV)] of the car by taking into account the purchase price, freight, insurance, handling and all other charges incidental to the sale and delivery of the car in Singapore Excise ... England Tianjin Automotive Test Centre A: Boxing Road, Beijing Economic and Technological Development Zone, Beijing, China B: Tianshanlukou, Chenglinzhuangdao, Tianjin, China 13 Annex B Page...

Ngày tải lên: 07/03/2014, 11:20

... Dewpura et al endogenous inhibitor, a catalytic domain characteristic of serine proteases and a C-terminal Cys- and His-rich domain implicated in enzyme stability and protein– protein interaction ... shots and masses were externally calibrated with All -in- 1 Protein Standards (Ciphergen Biosystems Inc.) All data were normalized for total ion current and peak areas calculated using the indirect ... the prodomain, the common naturally occurring A5 3V variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated with hypocholesterolemia...

Ngày tải lên: 16/03/2014, 06:20

... CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA ... run in a 3% agarose gel Each pair of lines have the same sample treated with and without the Ssp I enzyme An HIV sample having the AATATT site was used as positive control in lanes and 2, sample ... lanes and (negative control), 1000 bp ladder marker lane 5, sample 6290 lanes and 7, sample 467 lanes and sample 6516 lines 10 and 11, sample 6541 lanes 12 and 13 The samples 467 and 6516 treated...

Ngày tải lên: 19/06/2014, 08:20