... use it After you create a database, you must associate a user with a username and password with the database Joomla! asks you for that information during the installation process so, again, write ... Installing Joomla! 1.6 requires a series of steps on a Webserver Ǡ A MySQL database with a username, password, and database name is required Ǡ The database is created via the Website control panel ... the Category Manager opens a manager that includes Articles, Categories, and Featured Articles tabs The page opens automatically to the Categories tab Figure 2-4 shows the Category Manager: Articles...
Ngày tải lên: 29/05/2014, 23:54
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
... Novotny EA, Garrett-Beal L, Ward JM, Libutti SK, Richard Alexander H, Cerrato A, Parisi MJ, Santa Anna-AS, Oliver B, Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ: Molecular pathology ... 89:143-150 11 Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E, Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 gene causing familial isolated primary hyperparathyroidism ... A, Gallart L, Martín-Campos JM, Catasús L, Mayoral C, Mato E, Tortosa F, Bernà L, Rodríguez-Espinosa J, Blanco-Vaca F, Matías-Guiu X, de Leiva A, Mauricio D: Genetic, clinical, and biochemical...
Ngày tải lên: 09/08/2014, 01:24
báo cáo khoa học: "Lenalidomide induced good clinical response in a patient with multiple relapsed and refractory Hodgkin''''s lymphoma" pptx
... Lactate dehydrogenase (U/L) < 241 250 175 Aspartate aminotransferase (U/L) 8-30 20 16 Alanine aminotransferase (U/L) 10-36 16 Gamma-glutamyl transpeptidase (U/L) 9-35 15 10 Alkaline phosphatase ... physical condition and although her laboratory results showed mild leucopenia (World Health Organization hematologic toxicity scale grade 2), no dose reduction was required (Table 1) However, a third ... relapsed or refractory classical Hodgkin lymphoma [abstract] [http://ash.confex.com/ash/2009/webprogram/ Paper18377.html] Böll B, Borchmann P, Topp MS, Hänel M, Reiners KS, Engert A, Naumann...
Ngày tải lên: 10/08/2014, 22:21
báo cáo khoa học: "Oculomotor nerve palsy associated with bortezomib in a patient with multiple myeloma: a case report" pps
... 30353, AlKhobar, 31952, Saudi Arabia 2Radiology Department, Saad Specialist Hospital, Prince Faisal Bin Fahed Street, P.O Box 30353, AlKhobar, 31952, Saudi Arabia Authors’ contributions HE analyzed ... antagonists and neuropathy Journal of Muscle Nerve 2008, 37(3):281-292 Ravaglia S, Corso A, Piccolo G, Lozza A, Alfonsi E, Mangiacavalli S, Varettoni M, Zappasodi P, Moglia A, Lazzarino M, Costa A: Immune- ... immunomodulating agents, such as cyclosporin, tumor necrosis factor alpha antagonists (infliximab, etanercept, adalimumab), or to that of autologous peripheral blood stem cell transplantation, which have...
Ngày tải lên: 11/08/2014, 02:21
Báo cáo y học: " Concomitant homozygosity for the prothrombin gene variant with mild deficiency of antithrombin III in a patient with multiple hepatic infarctions: a case report" pdf
... lethargy with reduced appetite A unilateral leg oedema was noticed A gastroscopy was normal and a computed tomography (CT) scan confirmed splenomegaly (13.5 cm), though he had a normal liver and ... Epstein-Barr virus, hepatitis A virus and hepatitis C virus was negative An autoimmune screen was negative (rheumatoid arthritis, antinuclear antibody, anti-mitochondrial antibody, anti-liver ...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: "Fast-growing pancreatic neuroendocrine carcinoma in a patient with multiple endocrine neoplasia type 1: a case report" pptx
... Situs at laparotomy before and after resection (A) Intra-operative ultrasound at laparotomy (B) Situs at laparotomy (asterisk indicates the tumor; S, stomach; P, pylorus; PH, pancreatic head; D, ... a tumor in the pancreatic tail with a diameter of 25 mm without any radiological signs of malignancy Endoscopic ultrasound (EUS) visualized two small lesions in the pancreatic tail (Figure 1A) ... imaging procedures This patient was scheduled for a laparoscopic distal pancreatic resection after laparoscopic ultrasound (LUS) to rule out additional tumors in the pancreatic head and body At...
Ngày tải lên: 11/08/2014, 19:21
Báo cáo y học: "Resolution of cast nephropathy following free light chain removal by haemodialysis in a patient with multiple myeloma: a case report" ppsx
... FLC concentrations fall, intratubular casts can resolve within weeks Early diagnosis and treatment may facilitate reversal of acute renal failure This observation has important implications for ... manuscript CH, NA, MC and HO had significant roles in data gathering, analysis, interpretation and performing critical revisions to the manuscript AB and PC had a significant role in data gathering, ... was moderate diffuse interstitial fibrosis and tubular atrophy A diagnosis of multiple myeloma and acute renal failure due to cast nephropathy was made For the first weeks, the patient was managed...
Ngày tải lên: 11/08/2014, 19:21
Báo cáo y học: " Morphologically and immunohistochemically undifferentiated gastric neoplasia in a patient with multiple metastatic malignant melanomas: a case report" pot
... melanoma is 7.5 months with a 5-year survival rate of 6% Patients with GIT metastases have a median survival time of 12.5 months with a 5-year survival rate of 14% Survival is strictly related ... with multiple metastatic melanoma, who presented to our unit with vomiting and was later diagnosed with a gastric neoplasia with no histological and immunohistochemical characteristics referable ... appearance of multiple masses localized on the left arm, both axillae and at the level of the primary melanoma surgical scar The patient underwent a total-body bone scintigraphy that showed an...
Ngày tải lên: 11/08/2014, 23:21
OReilly.Building.a.Web.2.0.Portal.with.ASP.NET.3.5.Jan.2008-BBL
... Data access layer Encapsulates database access and provides an interface that is database and data source independent It also provides object factories that create Entity classes out of database ... with the database DatabaseHelper is a class used for performing common database operations DashboardDataContext is generated by LINQ to SQL and maps entities to database tables Data Model To ... that work with databases via DatabaseHelper and DatabaseContext On the web layer, Default.aspx is the entry point It uses DashboardFacade to perform operations such as adding a new tab or widget,...
Ngày tải lên: 15/11/2012, 14:24
Tài liệu Building a VoiP Network with multimedia Communication server 5100 docx
... online chat system that can be used at anytime So at anytime users can start their own chats and invite others; they could join a chat already established, such as a help desk chat Also, chats can ... 10 Chapter • Getting Started with the MCS 5100 Professional Assistant Services An assistant console may be added to any user so that they can take, screen, and handle all calls for another party.This ... Solutions Fast Track What Is the MCS 5100? It is a SIP-based multimedia and collaborative applications server that also provides PBX-based features It is an applications-based, communications-based...
Ngày tải lên: 25/01/2014, 17:20
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc
... 1078–1085 Sharma K, Chandra H, Gupta PK, Pathak M, Narayan A, Meena LS, D’Souza RC, Chopra P, Ramachandran S & Singh Y (2004) PknH, a transmembrane Hank’s type serine ⁄ threonine kinase from Mycobacterium ... suggested as one of the targets for a signal transduction pathway mediated by PknA and PknB If so, this pathway could link cell division and peptidoglycan synthesis with arabinogalactan synthesis, another ... were resolved by SDS ⁄ PAGE and the loss of labeling was visualized by autoradiography ATPase activity measurements The malachite green ATPase assay The reaction buffer contained 10 lL of 10· TMD...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo " Boundedness and Stability for a nonlinear difference equation with multiple delay " docx
Ngày tải lên: 22/03/2014, 11:20
Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx
... CAGCTAGCTGGCCGGGATAGC P1F P1R GCCGATCATATCTGCTATGG CCATAGCAGATATGATCGGC P2F P2R ATGTACAATTCAGCTCTTGCT AGCAAGAGCTGAATTGTACAT P3F P3R GCTGTTATACCAGTATATGG CCATAT ACTGGTATAACAGC P4F P4R TGGTGTACTAATTTGATCTATG ... GTCCTGTAAGCTTAAGTCGTGTC P3 P4 P6 TTCCCGCATCTCACACGTCA CATATCTGCTATGGATGTAC GTCACACCTTTCGTCGCAGC P8 94RTf 94RTr 1994intR TGTTATACCAGTATATGGTGTACTA CTCGGCCTCAACTACAGTCGT ACAGGTAGCTGAGCAGCAGAC CAGCTAGCTGGCCGGGATAGC ... TGGTGTACTAATTTGATCTATG CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA TCGGTCGACGCAGGGCCAAAG GTCCTCCGGTCGACTCG H2 Experiment CmtR protein expression CmtR protein expression Reporter assay EMSA Reporter...
Ngày tải lên: 23/03/2014, 04:21
peachpit press visual quickproject guide building a web site with ajax (2008)
... update the database report any errors test the non-Ajax version extra bits adding records via Ajax what we’ll add the Ajax elements apply the Ajax layer set up the Ajax prepare the form data complete ... phpMyAdmin access They may or may not let you create databases, though If not, just use the database you have already (assuming it does not have tables called departments and employees) • A database’s ... can’t take advantage of Ajax (because their browser doesn’t support JavaScript and XMLHttpRequest) Creating an Ajax-enabled application that will still function for non-Ajax-enabled browsers is a...
Ngày tải lên: 27/03/2014, 13:38
addison-wesley learning ipad programming, a hands-on guide to building ipad apps with ios 5 (2012)
... publisher was aware of a trademark claim, the designations have been printed with initial capital letters or in all capitals The authors and publisher have taken care in the preparation of this ... going right away and leave you with the ability to walk off and build your own application and apply the language or technology to whatever you are working on Learning iPad Programming A Hands-On ... inner game of debugging Debugging is a fundamental part of the day-to-day life of a programmer, and few books devote more than a paragraph or two to it Learning iPad Programming has an entire chapter...
Ngày tải lên: 24/04/2014, 09:56
building a user interface with forms
... navigation control − If want to change the navigation button caption, double-click the caption and type name the new Navigation Forms Creating a Two-Level Navigation Form: − To create navigation ... you can make changes in a field − Enabled lets you deactivate a control altogether Taking Control of Controls Prevent Errors with Validation: − Validation Rule sets an expression that the value ... Horizontal and Increase Vertical Decrease Horizontal and Decrease Vertical Anchoring: Automatically Resizing Controls Normally, the controls have a fixed, unchanging size Fixed size controls make...
Ngày tải lên: 04/05/2014, 19:59
building web applications with sasintrnet® a guide to the application dispatcher
... JSP, and Java applications that communicate with a SAS data server (either SAS/SHARE or the SAS Scalable Performance Data Server) via SQL queries The Java programs can let a user view and update ... organize, view, and maintain their projects visually It includes reporting, graphical, and analytical tasks, as well as more than 60 wizard-based tasks Advanced users can create programs that ... program is not available, it streams HTML back with a message to that effect Note: Only one Load Manager should be associated with a specific Application Server If multiple Load Managers are associated...
Ngày tải lên: 01/06/2014, 01:15