... the participants. Vartanian and Goel (2004) and Kawabata and Zeki (2004) asked their participants to express their aesthetic preferences only for artworks, and Cela-Conde et al. (2004) asked theirs ... tradeoff related with the use of artistic vs simple visual materials in experimental aesthetics: “In the former case, there is the advantage of studying reactions to real art and the disadvantage ... whether there are brain areas that are specifically active when they view paintings that they consider to be ugly” (Kawabata and Zeki, 2004, p. 1699). Vartanian and Goel (2004) carried out their
Ngày tải lên: 19/02/2014, 17:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC
Ngày tải lên: 23/03/2014, 13:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_10 pptx
... serve as catalysts for the further harmonisation and integration of the clearing industry, a network initiative that enables the potential partner CCPs to leverage their installed base ... step towards the further integration of the European capital market infr astructure. 184 The deal thus satisfied market participants’ demands for the continued consolidation of European clearing ... of clearing houses and for the creation of a user-controlled single European CCP based on a horizontal model. In the exchange arena, the fate of European exchange consolidation was at the centre
Ngày tải lên: 21/06/2014, 07:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_14 doc
... The Automation, Management, and Regulation of Financial Markets, Oxford et al 1998 (2000): ‘Promoting Regional Capital Market Integration’, Paper prepared for the Inter American Development ... Derivatives in the United States and in Europe: A Comparison’, European Central Bank, Occasional Paper Series, No 5, Frankfurt a. M... Global Clearing Link (case study) European Association ... Burns, Mary Ann/Acworth, Will (2006): ‘The FCM Strategy Play’, in: Futures Indus- try Magazine, March/April, online Publication, retrieved: 03.01.2007, available at: www.futuresindustry.org/fi-magazine-home.asp?a=1101.
Ngày tải lên: 21/06/2014, 07:20
Transforming Glycoscience: A Roadmap for the Future pptx
... materials, and nanomaterials There are many pathways to create a variety of functionalities on a glycan, creating a wide range... carbohydrates and glycoconjugates, be established as a ... Transforming Glycoscience: A Roadmap for the Future ix PREPUBLICATION COPY Preface Although I was trained as a synthetic organic chemist and was involved in carbohydrate research early ... International Standard Book Number Copyright © National Academy of Sciences. All rights reserved. Transforming Glycoscience: A Roadmap for the Future PREPUBLICATION COPY The National Academy
Ngày tải lên: 29/06/2014, 09:21
A review of lean six sigma and malcolm baldrige national quality award and a proposal for the future
... Lean Six Sigma and Malcolm Baldrige National Quality Award on an Execution Basis 18 Table 4.3 Comparing Lean Six Sigma and Malcolm Baldrige National Quality Award on an Impact Basis 19 Table ... A REVIEW OF LEAN SIX SIGMA AND MALCOLM BALDRIGE NATIONAL QUALITY AWARD AND A PROPOSAL FOR THE FUTURE PNG CHANG LIANG NATIONAL UNIVERSITY OF SINGAPORE 2014 A REVIEW OF LEAN SIX SIGMA AND ... Tummala VMR, Tang CL. (1996). Strategic quality management, Malcolm Baldrige and European quality awards and ISO 9000 certification: Core concepts and comparative analysis. International Journal
Ngày tải lên: 26/09/2015, 09:48
Khan global markets and financial crises in asia; towards a theory for the 21st century (2004)
... Global Markets and Financial Crises in Asia Towards a Theory for the 21st Century Haider A Khan Global Markets and Financial Crises in Asia This page intentionally left blank Global Markets and ... Yanagihara, ‘Asian Development Before and After the Crisis: Some Stylized Facts and Paradigmatic Features with an Agenda for Future Research’, manuscript, ADBI, February 1999 Khanna, Tarun and ... Global Markets and Financial Crisis: Asia’s Mangled Miracle (Basingstoke: Macmillan and St Martin’s Press, forthcoming a) Khan, Haider Ali, Innovation and Growth in East Asia: The Future of Miracles
Ngày tải lên: 29/03/2018, 13:40
A Strategy for the Adventist Church to Reach the Increasingly Sec
... place in a meeting: sharing and caring, praying for each other, studying and learning, a ministry for others and food There is a wealth of literature50 on the practical aspects of running a small ... Kalvaag and Kalvaag, The Café Church - 182 information, teaching, and/or other input for the group members to feel that they are growing Learning, in relationship to the issues the participants ... element: prayer for each other God’s blessings and guidance are asked on the issues that each person faces Intercessory prayer will bring the members of the group together Susanne and Cyril Kalvaag51
Ngày tải lên: 25/10/2022, 02:48
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... Furuyama1, Kiriko Kaneko1, Yuanying Ding1, Kazuhiro Ogawa2,*, Miki Yoshizawa1, Masaki Kawamura1, Kazuhisa Takeda1, Tadashi Yoshida3 and Shigeki Shibahara1 Department of Molecular Biology and Applied Physiology, ... compared to h: *P < 0.05; **P < 0.01 sion number AAG09721) are located adjacently in a head-to-head orientation, and their transcription start sites are 1.5 kb apart We therefore analyzed the ... Kitamuro T, Takahashi K, Ogawa K, Udono-Fujimori R, Takeda K, Furuyama K, Nakayama M, Sun J, Fujita H, Hida W et al (2003) Bach1 functions as a hypoxia-inducible repressor for the heme oxygenase-1 gene
Ngày tải lên: 19/02/2014, 06:20
Healthy Child, Healthy Future: A Framework for the Universal Child Health Promotion Programme in Northern Ireland doc
... Speech and Language Therapy for Children (Northern Ireland) An Information Pack Referral Guidance, April 2010 Page 64 Healthy Child, Healthy Future A Framework for the Universal Child Health Promotion ... flexible and innovative to ensure that all families are able to access and benefit from the advice, support and services that are available to them We are enormously grateful to all the professionals ... Murray L and Andrews L (2005) The Social Baby: Understanding babies’ communication from birth London: CP Publishing National Collaborating Centre for Mental Health (2007) Antenatal and Postnatal
Ngày tải lên: 14/03/2014, 09:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_1 pptx
... that clearing is a topic that has always been regarded as sort of an operational thing The exchanges’ matching engines have had the glamour But I think in the long run the value added of clearing ... timely and well worth reading, given the many changes afoot in the areas of exchange regulation and clearing.’ HARVEY L PITT Chief Executive Officer of Kalorama Partners and former Chairman of the ... post-trade infrastructure has become both a focus area for market participants13 and a goal for official policy14 – particularly in the United States (US) and Europe.15 Despite this shared goal, there...
Ngày tải lên: 20/06/2014, 18:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_2 pptx
... importantly, collateral management ensures that margin requirements are covered by available collateral If there is a collateral shortfall, a collateral call is generated If there is collateral ... novation, netting and risk management, as well as transaction/position management, collateral management and cash management The scope of netting and risk management services that a CCP can offer ... risk.86 Variation margin is a payment made when the market price of a transaction has changed.87 It is therefore a risk management tool to cover the latest exposure Variation margin is called for...
Ngày tải lên: 20/06/2014, 18:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_4 potx
... on analysing the impact that certain integration and harmonisation initiatives between clearing houses can have on the transaction costs of clearing These integration and harmonisation initiatives ... compliance with a clearing house’s risk management requirements can be regarded as an offset for the risk assumed by the CCP for the clearing members and for the savings in risk management gained ... upgrades or other changes and infrastructure adaptations Dealing with a CCP also entails costs for the banking intermediaries Clearing houses usually demand that all clearing members hold dedicated...
Ngày tải lên: 20/06/2014, 18:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_5 potx
... capital was mainly based on the following arguments: r collateral-rich clearers have enough capital available; r clearing houses can serve as a cheap form of custody; and r clearing houses pay ... that are collateral rich and those that are collateral poor.34 The collateral poor tend to be the large trading houses, such as arcades,35 with a high proportion of day trading and low capital ... illustrate, for example, the number of respondents supporting or opposing a particular concept or idea These quantitative overviews establish the basis for a further qualitative data analysis and...
Ngày tải lên: 20/06/2014, 18:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_6 doc
... mainly affecting the indirect cost categories All of these factors are detailed in the following paragraphs Whereas the validation of the data on clearing house charges revealed that the above-mentioned ... vital As the analysis has shown, the organisation of derivatives clearing could serve as a role model for other parts of the European market infrastructure As outlined above, to evaluate the ... understanding the respective value provision of their clearer It is therefore doubtful whether they can accurately assess the adequacy of intermediary charges The remaining four NCMs had a good and...
Ngày tải lên: 20/06/2014, 18:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_7 pdf
... studies, a relying on a broader sample of data available for their focus area Book (2001) on the other hand copes with the problems related to the limited availability of data for his research by ... other indicators for a quantification of the output (e.g balance sheet variables such as revenue or profit) is not adequate for this analysis, as these indicators generate a biased picture for a ... depreciation The variables are based on publicly available information, which can be found 226 Clearing Services for Global Markets The analysis supports that decreasing average costs are related to an...
Ngày tải lên: 20/06/2014, 18:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_9 docx
... Regionally-to-globally active clearers in particular can thus benefit from direct access to the away market: Many of the Asian brokerage firms tend to be smaller; they don’t have the capital of a Morgan Stanley ... comparable 7.4.2 Transaction Cost Impact Matrix r The Transaction Cost Impact Matrix analysed whether or not the demand- and supply-side scale effects of each network strategy translate into a ... side, and there is a cost involved So links are difficult things; unless you can persuade both parties that there is an advantage to each of them there is always a different advantage to the parties...
Ngày tải lên: 20/06/2014, 18:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_10 pdf
... between the London Clearing House Ltd (LCH) and the Paris-based clearing house Clearnet SA This network initiative provides valuable material for a case study analysis for various reasons The transaction ... important findings relevant for future M &A deals between European CCPs Additionally, the initiative was undertaken long enough ago to furnish a fairly substantial period for analysis On the other hand, ... global presence that enables them to clear internally all of the most important marketplaces worldwide The global clearers already had the efficiencies in-house, within their global organisation,...
Ngày tải lên: 20/06/2014, 18:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_12 pdf
... partners usually not have the leeway to benefit from and further leverage their installed base r Single CCP initiatives (as a particular form of M &A initiatives) have the drawback that the majority ... conceivable way, but if managers look at usage in the aggregate, they will see patterns emerge And that’s important because for each major usage pattern that managers identify in their network, they ... network strategy As the calculation of costs is based on the results presented in section 5.2.3, the same caveats apply to the figures presented in the following.1 For details on the quantitative analysis...
Ngày tải lên: 20/06/2014, 18:20
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_13 ppt
... extensive qualitative data obtained from the interviews served as vital input and formed the basis for the cost analyses and case studies Nonetheless, more research based on quantitative data is needed ... regulatory and political issues can create further uncertainty about the future 434 Clearing services for global markets development of a clearing link initiative and can thus potentially aggravate the ... clearing houses have traditionally lacked a clear stand-alone value proposition and their managers will face hurdles in implementing such a strategy, these firms nonetheless have the greatest incentive...
Ngày tải lên: 20/06/2014, 18:20