... PP30[hHsp9 0b] Ten micrograms of total soluble protein was gel fractionated, and < /b> then western blotted; the < /b> blot was then probed with < /b> anti-(Achlya Hsp90) monoclonal serum The < /b> bands indicated by an asterisk ... GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse primer CA GTAGCTTCATCTTTCGATCGACTTCTTCCATGCGA GA) The < /b> second PCR used a < /b> universal pair of primers [34,48] PJ69- 4a < /b> [48] was then transformed with < /b> ... signal-regulated kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a < /b> and < /b> Hsp9 0b, as well as the < /b> native yeast Hsp90s, were all capable of activating GR in these...
Ngày tải lên: 23/03/2014, 07:20
... form a < /b> distorted chair The < /b> C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available ... synthesis was from Rapp Polymere (Tubingen, Germany), and < /b> all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the < /b> individual a-< /b> and < /b> b- domains The < /b> individual a-< /b> and < /b> b- domains ... still the < /b> possibility that the < /b> separated domains are simply incapable of binding more than three and < /b> four Cu(I) without aggregating and < /b> denaturing, whereas in the < /b> native MT-1, the < /b> presence of the...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... affinity, K, can be derived for both the < /b> a < /b> and < /b> b subunits from the < /b> averaged parameters of HbA oxygenation (Table 1, Average) The < /b> association and < /b> dissociation rate constants for the < /b> b subunits are found ... ligands leaves the < /b> a < /b> subunits (Table 1, ), and < /b> in every six ligands leaves the < /b> b subunits (Table 1, ) Using Eqns (3) and < /b> (4), the < /b> dissociation rate constant, k, and < /b> the < /b> O2 affinity, K, can ... Here k a < /b> and < /b> k b are, respectively, the < /b> rate constants of BR for the < /b> a < /b> and < /b> b subunits within triliganded HbA Time courses for O2 rebinding are shown in Figs and < /b> The < /b> transient absorption decays were...
Ngày tải lên: 16/03/2014, 14:20
The a and b adapters are used as priming sites for both amplification
... Preparation of the < /b> DNA • DNA is fragmented by nebulization • The < /b> DNA strand’s ends are made blunt with < /b> appropriate enzymes • A< /b> and < /b> B adapters are ligated to the < /b> blunt ends using DNA ligase ... filters all DNA rich beads from empty beads, and < /b> then extracts the < /b> biotin beads from the < /b> DNA rich beads • The < /b> DNA in the < /b> beads are denatured again using sodium hydroxide, creating ssDNA rich beads ... since their composition is known • The < /b> B adapter contains a < /b> 5’ biotin tag used for mobilization • The < /b> beads are magnetized and < /b> attract the < /b> biotin in the < /b> B adaptors Filtering the < /b> Mess • There are...
Ngày tải lên: 19/03/2014, 22:32
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx
... for the < /b> phylogenetic analysis Enzyme Species GenBank/EBI A < /b> transferase A < /b> transferase A < /b> transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal transferase Gal transferase Gal transferase Gal transferase ... members, the < /b> ABO gene itself, the < /b> a3< /b> galactosyltransferase (pseudo B) gene [17], the < /b> aN-acetylgalactosaminyltransferase or Forssman synthetase gene [18] and < /b> the < /b> a-< /b> galactosyltransferase iGb3 synthetase ... Ó FEBS 2002 kidney, the < /b> urinary bladder, the < /b> uterus and < /b> the < /b> thymus A < /b> weaker signal was obtained from the < /b> pancreas and < /b> very weak, barely detectable, signals were visible from a < /b> salivary gland,...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo hóa học: " Research Article A Hilbert-Type Linear Operator with the Norm and Its Applications" pdf
... theoretical analysis and < /b> applications These inequalities and < /b> their integral forms have been recently extended or strengthened in 4–8 Zhao and < /b> Debnath obtained a < /b> Hilbert-Pachpatte’s reverse inequality ... Mathematics and < /b> Its Applications (East European Series), Kluwer Academic Publishers, Dordrecht, The < /b> Netherlands, 1991 M Gao and < /b> B Yang, “On the < /b> extended Hilbert’s inequality,” Proceedings of the < /b> ... proved that 1.7 and < /b> 1.8 are two equivalent inequalities and < /b> their constant factors π/sin π/p and < /b> π/sin π/p 2p are the < /b> best possible When α 1, the < /b> expressions 1.7 and < /b> 1.8 can be reduced to 1.3 and...
Ngày tải lên: 22/06/2014, 02:20
Báo cáo khoa học: " Modeling effect of the septic condition and trauma on C-reactive protein levels in children with sepsis: a retrospective study" pdf
... septic category with < /b> diagnosis as predictors (model B) both reduces the < /b> variability of baseline CRP values and < /b> their rates of change by about 20% and < /b> 1.5%, respectively Because the < /b> variation remains ... groups are quite small We had to deal with < /b> the < /b> data we had available There were no more patients in the < /b> most severe category (fortunately for the < /b> patients) The < /b> estimates, however, can be biased by ... (which is actually model A)< /b> and < /b> DG, and < /b> based on these analyses we could draw the < /b> same conclusions concerning SEP and < /b> DG as we already had done Since the < /b> analysis was intended as exploratory, we...
Ngày tải lên: 13/08/2014, 03:21
Tài liệu Global Warming A Mind Mapper''''s Guide to The Science and Solutions pdf
... natural as well as manmade part of the < /b> - Scientist at NASA, Dr James Hansen earth’s atmosphere which have the < /b> ability to trap and < /b> retain heat) in the < /b> atmosphere and < /b> re-emitted back to the < /b> earth ... ABOUT JANE GENOVESE Jane Genovese is a < /b> public speaker, university graduate of Law and < /b> Arts (majoring in Psychology) and < /b> passionate global warming advocate She became concerned about global warming ... such a < /b> disturbing celebrities and < /b> gossip, accumulating more and < /b> more place, acting like zombies in the < /b> material wealth and < /b> the < /b> next holiday overseas than face of global catastrophe? with < /b> the < /b> survival...
Ngày tải lên: 17/12/2013, 02:15
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... FEBS G Vaaje-Kolstad et al Degradation of a-< /b> and < /b> b- chitin The < /b> degradation rates of a-< /b> and < /b> b- chitin were assayed with < /b> LlChi1 8A < /b> in the < /b> presence or absence of LlCBP3 3A < /b> As both chitin variants, and < /b> ... machineries, such as in the < /b> lactic acid bacterium (LAB) Lactococcus lactis ssp lactis IL1403 LABs are Gram-positive, facultatively, anaerobic, fermentative bacteria that are of major importance in the < /b> food ... to as LlChi1 8A)< /b> ; a < /b> secreted family 33 CBP (yucG; protein referred to as LlCBP3 3A)< /b> ; and < /b> a < /b> family 20 N-acetylhexosaminidase (LnbA) The < /b> chiA and < /b> yucG genes are separated by 19 bp in an operon starting...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx
... recombinant CnAa and < /b> CnAb baculoviruses (Fig 1B, C) Kinetic assays of CaNa and < /b> CaNb phosphatase activity Fig SDS/PAGE and < /b> Western blot analysis of baculovirus expressed CaN composed of CnAa or CnAb ... findings that the < /b> CnAa and < /b> CnAb catalytic subunits confer differences in substrate affinity and < /b> phosphatase activity (as shown by Table Summary of kinetic parameters of CaNa and < /b> CaNb phosphatase activities ... sequences of the < /b> CnAa and < /b> CnAb catalytic, CaM-binding, and < /b> CnBbinding domains, it was surprising to find differences in the < /b> phosphatase activities between CaNa and < /b> CaNb toward the < /b> same substrate The < /b> results...
Ngày tải lên: 24/03/2014, 03:21
Behind with the Laundry and Living off Chocolate pdf
... to say the < /b> least She was completely besotted with < /b> the < /b> gorgeous Mark but hadn’t the < /b> courage to anything about it Every day, Laura was faced with < /b> a < /b> barrage of what Mark said or didn’t say, what ... people there, all laughing, chatting and < /b> trying to talk to each other above the < /b> music blaring out You can just about see someone at the < /b> other end of the < /b> room between the < /b> heads 30 Behind with < /b> the < /b> Laundry:Behind ... that I’d love to be able to say I had achieved, and < /b> at the < /b> very top of the < /b> list was my wish to become a < /b> professional dancer It was a < /b> long time ago now but dancing was in my blood I was passionate...
Ngày tải lên: 28/03/2014, 19:20
Providing Clinicians with the Skills and Tools to Assess, Prevent and Treat Pediatric Obesity pdf
... theoretical rationale and < /b> art of constructive and < /b> culturally sensitive weight counseling for behavioral change The < /b> HOPE curriculum is web-based and < /b> is available to both future and < /b> current clinicians across ... and < /b> To know the < /b> specific eating and < /b> physical activity behaviors that promote maintenance of healthy weight BEHAVIORAL COUNSELING FOR To become familiar with < /b> the < /b> stages of obesity management and < /b> ... AMERICAN ASIAN/PACIFIC ISLANDER BUILDING A < /b> SYSTEM FOR OBESITY MANAGEMENT ADVOCACY AND < /b> CHILDHOOD OBESITY The < /b> HOPE Project ADVOCACY AND < /b> CHILDHOOD OBESITY To be aware of social, economic, and < /b> environmental...
Ngày tải lên: 28/03/2014, 21:20
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt
... significantly increased mass signals of sodium and < /b> potassium alkali metal and < /b> various di- and < /b> tri-alkali metal adducts if standard solvents with < /b> 0.1% formic acid were used for the < /b> UPLC separation ... mM ammonium formate One half of each sample was separated by UPLC after in-gel acetylation and < /b> digestion without further modification (A)< /b> The < /b> second part of the < /b> sample was separated after further ... the < /b> plastid stroma after import and < /b> before the < /b> protein is assembled into an enzymatically active form As a < /b> number of groups have found that accumulation of PORA in the < /b> plastid stroma is a < /b> substrate-independent...
Ngày tải lên: 30/03/2014, 02:20
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... 45 by up-regulating the < /b> synthesis and < /b> release of endogenous basic fibroblast growth factor J Biol Chem 268, 17397–17403 Lianos, E .A < /b> & Bresnahan, B .A < /b> (1999) Effect of thromboxane A2< /b> inhibition and < /b> ... antagonism on prostaglandin and < /b> leukotriene synthesis in glomerular immune injury J Laboratory Clin Med 134, 478–482 Ushikubi, F., Aiba, Y., Nakamura, K., Namba, T., Hirata, M., Mazda, O., Katsura, ... the < /b> large distance, 1000 bp, between the < /b> first strand cDNA primer, Kin58 and < /b> the < /b> putative 5¢ terminus of the < /b> TPb mRNA transcript (data not shown) Thereafter, employing a < /b> second 5¢ RACE approach...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC 726,713 ... 90 pI tI BbsI XhoI BbsI CG ACCTCCG TTG G G G AG AAG G G G AG TCTTCTCG TAG ACCG AG AAG ACCTACCTG CAACAAAAAATG G T G G G CTG AG CTTCAACCCCCCCTCTCAG AG AAG CTCATCTTCTG CTG ATG ACCG TTTTTTACA G G G ... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học:" Dynamical analysis of a biological resource management model with impulsive releasing and harvesting" pdf
... Dynamical analysis of a < /b> biological resource management model with < /b> impulsive releasing and < /b> harvesting Jianjun Jiao∗1 , Lansun Chen2 and < /b> Shaohong Cai1 School of Mathematics and < /b> Statistics, ... Introduction Biological resources are renewable resources Economic and < /b> biological aspects of renewable resources management have been considered by Clark [1] In recent years, the < /b> optimal management ... this article to analyze the < /b> exploitation of the < /b> predator–prey model with < /b> impulsive releasing and < /b> harvesting at different moments Impulsive delay differential equations are suitable for the < /b> mathematical...
Ngày tải lên: 21/06/2014, 17:20