blazing a trail through the data jungle

A Transect Through the Foreland and Transitional Zone of Western

A Transect Through the Foreland and Transitional Zone of Western

... o u g h o u t a r r a y s in the f o o t w a l l and h a n g w a l l that are t r u n c a t e d by the ramp A -5 92 Trang 14A -5f r a c t u r e s i n d i c a t e s that the f r a c t u r e s ... e l a t i v e l y p l a n a r and the fault zone is thick In c o m p a r is o n the u p p e r b e d d i n g p l a n e f a u l t s are f o l d e d in the ramp areas, cut by ramp faults, and the ... g h a n g l e n o r m a l f a u l t s have b e e n m a p p e d a l o n g the C h a m p l a i n t h r u s t fault and in cut the e a s t e r n part of the p l a t f o r m s e q u e n c e are M

Ngày tải lên: 25/10/2022, 03:14

29 3 0
Báo cáo y học: "The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions" potx

Báo cáo y học: "The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions" potx

... However, there is a constellation oftypes of affective episodes that are not part of the officialclassification and they are so prevalent in real life clinicalpractice that many authors consider them ... of passion' being the most tragic result The drug abuse pattern of BD patients tends toward the abuse of stimu-lant drugs Familial diathesis for mania is significantly associated with the abuse ... well as the amygdala and the hippocampus Mood disorders are characterised by a constellation of symptoms and signs The terms 'depressed mood', 'anhe-donia' and 'elevated mood' are central to the

Ngày tải lên: 08/08/2014, 23:21

22 424 0
Báo cáo y học: "Looking through the ''''window of opportunity'''': is there a new paradigm of podiatry care on the horizon in early rheumatoid arthritis" pot

Báo cáo y học: "Looking through the ''''window of opportunity'''': is there a new paradigm of podiatry care on the horizon in early rheumatoid arthritis" pot

... Case-series data reveal the early stages of irreversible foot-related walking disability and, by detailed gait analysis, functional impairment at the ankle, tarsus and MTP joints [24] What are the consequences ... but the area has been identified as a research priority A new paradigm for podiatrists focuses on combination therapy targeted at inflammatory lesions and associated mechanically-based impairments ... and manufacture capabilities where available Orthotics treatment can be combined with exercises, gait training, and therapeutic footwear, as well as joint protec-tion and disease management advice

Ngày tải lên: 10/08/2014, 21:24

10 388 0
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataatttgag G K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa Figure 3 Full-length cDNA and deduced protein of CcGCC1 gene Start and stop codons are underlined ... D I P Q 541 ctttacatgaaaatgagcatgcaaataagagaggcacttcaattgcagctagaactcgag L Y M K M S M Q I R E A L Q L Q L E L E 601 aagcatcttcatgatcaattagagatgcaaatgaatttacaaaagctgattgaggatcaa K H L H D Q L

Ngày tải lên: 11/08/2014, 11:21

14 400 0
Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf

Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf

... Burnaby, BC, V5A 1S6, Canada Abstract Background: The potential of using skin as an alternative path for systemicallyadministering active drugs has attracted considerable interest, since the creation ... Trang 1R E S E A R C H Open AccessA novel approach to modelling water transport and drug diffusion through the stratum corneum Tatiana T Marquez-Lago1,2*, Diana M Allen3*, Jenifer Thewalt4 ... although devoid of a metabolism, confer most of the skin resistance tochemical and physical attacks, and in their normally dehydrated state also provide obstacles against water loss through the

Ngày tải lên: 13/08/2014, 16:20

25 373 0
Báo cáo y học: "Time use choices and healthy body weight: A multivariate analysis of data from the American Time use Survey" pot

Báo cáo y học: "Time use choices and healthy body weight: A multivariate analysis of data from the American Time use Survey" pot

... cross-sectional time diary data of the type available in the ATUS have two disadvantages First, time spent in various activities on any given day may deviate from an individual’s usual time use pat-terns ... primary meal preparer, self-identification as the primary grocery shopper, whether the diary day was a weekend, whether the diary day was in the summer, whether the diary day came from 2007, the ... an average of a little more than an hour a day in eating where that is the main focus of their attention They also spend more than 20 minutes per day on average engaged in eating as a secondary

Ngày tải lên: 14/08/2014, 08:20

14 337 0
A STUDY ON HOW SCRIPTWRITERS FLOUT CERTAIN MAXIMS OF GRICE’S COOPERATIVE PRINCIPLE TO CREATE VERBAL IRONY THROUGH THE SITCOM FRIENDS FROM EPISODE 1 TO EPISODE 10

A STUDY ON HOW SCRIPTWRITERS FLOUT CERTAIN MAXIMS OF GRICE’S COOPERATIVE PRINCIPLE TO CREATE VERBAL IRONY THROUGH THE SITCOM FRIENDS FROM EPISODE 1 TO EPISODE 10

... placing the spectator a step ahead of at least one of the characters.‖ This means that dramatic irony is characterized by a incongruity between what the audience knows to be true and what the ... potential for humour These characters remain essentially the same, rather than developing as they would in comedy drama.‖ To make it clearer, Wikipedia suggests that sitcom is usually a narrative-based ... factors, among which, the great potential for verbal irony created by the language used itself plays an important part The verbal irony appeared in the series have not only attracted the young but also

Ngày tải lên: 02/03/2015, 14:22

91 882 0
Developing students' reading proficiency through extensive reading in an IELTS prepation course - A case of the 3rd year English majors at Hanoi University of I

Developing students' reading proficiency through extensive reading in an IELTS prepation course - A case of the 3rd year English majors at Hanoi University of I

... Kaplan (1966) has claimed that –Each language and each culture has a paragraph order unique to Trang 20itself, and … part of the learning of a particular language is the mastery of its logical ... to another in such a way that changes in that factor are causually related to another in such a way that changes in that factor are causually related to changes in the other So, it’s not just a ... use them at all Scanning for specific information Summarizing Identifying parts of speech Paraphrasing Sequencing 3 Matching paragraph headings with paragraphs in the reading passage The reading

Ngày tải lên: 28/03/2015, 10:27

67 824 0
Thai Literature at the Crossroads of Modernity  Advancing a Critique of Neo-liberal Development through the Writings of Khamsing Srinawk and Chart Korbjitti

Thai Literature at the Crossroads of Modernity Advancing a Critique of Neo-liberal Development through the Writings of Khamsing Srinawk and Chart Korbjitti

... machine” (within a “dog eat dog” capitalist framework) Most Thais accept the frequently repeated mantra that to be Thai is to trust in nation, religion, and monarchy (chaat, satsanah, mahakaset) ... consumerist materialism In modern Thailand, traditional values and the institutions that legitimate these values – the sangha and the monarchy – are losing their once revered status in the wake of ... that a fusion of military power and royal legitimacy was reestablished” by utilizing the symbols of Trang 33 nation, religion, and monarchy (chaat, satsanah, mahakaset) to further the military’s

Ngày tải lên: 14/05/2015, 12:09

132 839 0
The data is highdimensional  The desire of projecting those data onto a lowerdimensional subspace without losing importance information regarding some characteristic of the original variables

The data is highdimensional  The desire of projecting those data onto a lowerdimensional subspace without losing importance information regarding some characteristic of the original variables

...  Afterwards he hears an announcement from radio that a small earthquake just happened  Since the alarm has been going off during an earthquake  He concludes it is more likely that earthquake ... earthquake causes the alarm Trang 5Graphical Models An overview  Graphical models (probabilistic graphical models) are results from the marriage between graph theory and probability theory ... Parameter learning: Quantitative dependencies between variables are parameterized conditional distributions Parameters of the functions are parameters of the Trang 18Graphical models Approaches

Ngày tải lên: 12/10/2015, 08:52

57 201 0
The study of the mediation of ohanin, a king cobra (ophiophagus hannah) toxin through the central nervous system

The study of the mediation of ohanin, a king cobra (ophiophagus hannah) toxin through the central nervous system

... Siang, Yajnavalka Banerjee, Nandha Kishore, Pawlak Joanna, Syed Rehana, Dileep Gangadharan, Mr Koh Cho Yeow, Ms Liu Ying and Ms Tay Bee Ling, who make up the “Prof Kini’s Lab” staff, students and ... the Animalia kingdom, Chordata phylum, Vertebrata subphylum, the Reptilia class and Squamata order (Evans, 2003) Venomous Snakes There are many different and diverse species of animals across all ... Cobras, coral snakes, kraits, mambas, sea snakes, sea kraits and Australian elapids Viperidae (viperids) True vipers and pit vipers, including rattlesnakes Table 1 Snakes that known to cause dangerous

Ngày tải lên: 16/10/2015, 15:35

79 283 0
DSpace at VNU: Mapping Ground Subsidence Phenomena in Ho Chi Minh City through the Radar Interferometry Technique Using ALOS PALSAR Data

DSpace at VNU: Mapping Ground Subsidence Phenomena in Ho Chi Minh City through the Radar Interferometry Technique Using ALOS PALSAR Data

... place 2.3 SAR Data The Phased Array L-band Synthetic Aperture Radar (PALSAR) of the ALOS (Advanced Land Observation Satellite) data descending stack is from the Japan Aerospace Exploration Agency ... ESA data, e.g., ENVISAT ASAR, suitable for such applications, which typically require a stack of multi-temporal data In this work, we find that the ALOS PALSAR data are the best dataset available ... is the average backscatter ALOS PALSAR data Furthermore, we assume that there is no obvious seasonal variability, so that the subsidence history can be approximated by a linear function Such an

Ngày tải lên: 16/12/2017, 15:01

30 134 0
Rolfe  troob   monkey business; swinging through the wall street jungle (2000)

Rolfe troob monkey business; swinging through the wall street jungle (2000)

... classmates that day already knew exactly what game was being played There were bastards there who knew what awaited them, and had voluntarily come back to subject themselves to the process, all ... banking ladder are as-sume that the associates are a happier lot than the the ability to ease their own misery by heaping agony onto Since the investment banks are in the aforementioned practice ... we had seen might be Trang 8We reasoned that many careers have a painful rite of passage attached to them The medical profession has med school and residencies The legal occupation has Trang

Ngày tải lên: 29/03/2018, 14:37

144 142 0
Jodi a  mindell   sleeping through the night  ho eep (v5 0)

Jodi a mindell sleeping through the night ho eep (v5 0)

... incredible:circling the block in their car at 3:30 a.m wearing their pajamas with mismatchedsocks, their baby sleeping peacefully in the car seat, trying to imagine how they aregoing to explain the situation ... weeks have their days and nights switched, sleeping like a baby all day but awake and active at night Parentsshould increase their baby’s activity during the day (especially waking for feedings)and ... behavior The Soggy Potato Chip Theory There is another theory that has been nicknamed the soggy potato chip theory Thistheory states that a soggy potato chip is better than no potato chip at all

Ngày tải lên: 12/07/2018, 16:27

260 124 0
Brooks and kim the individual investor and the weekend effect   a reexamination with intraday data

Brooks and kim the individual investor and the weekend effect a reexamination with intraday data

... the transaction t-statistics are based on the null hypothesis that the average dollar volume on Monday is the same as the average dollar volume for the rest of the week QYuesday through Friday) ... the trade initiator and is defined as a transaction above the contemporaneous bid-ask spread midpoint A sale is a transaction below the bid-ask spread mid- point.3 Trades at the bid-ask spread midpoint ... trade returns are based on the last transaction for each period Bid to bid and ask to ask returns are based on the standing quote at the end of each period A and I are the unconditional returns

Ngày tải lên: 14/07/2018, 10:25

13 125 0
Brooks and kim the individual investor and the weekend effect   a reexamination with intraday data

Brooks and kim the individual investor and the weekend effect a reexamination with intraday data

... the transaction t-statistics are based on the null hypothesis that the average dollar volume on Monday is the same as the average dollar volume for the rest of the week QYuesday through Friday) ... the trade initiator and is defined as a transaction above the contemporaneous bid-ask spread midpoint A sale is a transaction below the bid-ask spread mid- point.3 Trades at the bid-ask spread midpoint ... trade returns are based on the last transaction for each period Bid to bid and ask to ask returns are based on the standing quote at the end of each period A and I are the unconditional returns

Ngày tải lên: 04/09/2018, 09:05

13 156 0
a path with heart -  a guide through the perils and promises of spiritual l- jack kornfield

a path with heart - a guide through the perils and promises of spiritual l- jack kornfield

... absolutely right It takes an egg as well as a sperm to start a Nobel laureate Every one of them has had a mother as well as a father You can say all you want of fathers, but their contribution ... they asked, “Then what are you?” He replied simply, “I am awake.” The word Buddha means to awaken How to awaken is all he taught Meditation can be thought of as the art of awakening Through the ... joys and sorrows, pleasant events and unpleasant events, individuals, nations, even civilizations, arise and pass away Take the one seat of a Buddha and rest with a heart of equanimity and compassion...

Ngày tải lên: 11/06/2014, 12:01

250 469 0
the psychopath test_ a journey through the madne - jon ronson

the psychopath test_ a journey through the madne - jon ronson

... midst of quite a bad anxiety attack I had been interviewing a man named Dave McKay He was the charismatic leader of a small Australian religious group called The Jesus Christians and had recently ... was a religious scholar from Iran.” “They were all academics,” said James They had all received the package the exact same way Deborah had—in a padded envelope from Gothenburg upon which was written ... force tasked with defeating the Goliath And they have won some epic victories There was, for example, their campaign back in the 1970s and 1980s against the Australian psychiatrist Harry Bailey...

Ngày tải lên: 06/07/2014, 01:59

150 552 1
A way through the maze the challenges of maintaining UK pension schemes

A way through the maze the challenges of maintaining UK pension schemes

... many firms rather than a single, monolithic balanced manager Financial innovation is also playing a part in the changed landscape “Multi-asset funds now have more tools at their disposal,” says ... Raj Mody, a partner and actuary at the pensions practice of PricewaterhouseCoopers, believes that LDI can be a crude, unreliable and expensive approach He advocates a proprietary strategy that ... The fewer assumptions they have to make the better,” says Mr Blackmore “They all adjusted their price according to the additional data when it came in.” Are bulk annuities for everyone? Blackmore...

Ngày tải lên: 06/12/2015, 23:05

26 223 0
Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx

Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx

... should take the time to stop and appreciate the beauty of the places that, as golfers, we get to enjoy I was having a particularly bad day on a course in Pagosa Springs, Colorado After yet another ... between the ninth and tenth holes Naturally, they heard all about what had taken place Later, at the nineteenth hole, we learned that they’d talked about my mishap for most of the back nine.Apparently, ... putting and hand them to us This made the round easy and very pleasant I have an electric handcart One day I hadn’t charged the battery fully and it ran out of juice As I was pushing it back to the...

Ngày tải lên: 22/02/2014, 08:20

223 405 0
w