... cDNA sequence of rat TLR4 (GenBank accession NM_019178) were: 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2), 5’-GAGCCGGAAAGUUAUUGUG-3’ (siRNA3) All siRNAs were chemically ... stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) (37) MAPKs are important for intracellular signal transduction and play critical roles in regulating neural plasticity and inflammatory ... system (Amersham Pharmacia Biotech, Uppsala, Sweden) Histone3 (Sigma, St Louis, MO, USA, 1:500) was used as an internal control Statistical analyses Data are expressed as mean ± standard deviation...
Ngày tải lên: 25/10/2012, 11:48
... kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄ L12, annexin A2 , annexin A5 , aldolase A, fascin and peroxyredoxin 1] displayed quantitative ... Sequence coverage (%) Fb Pb Observed change RPLP2 Parathymosin eIF 5A isoform B L7 ⁄ L12, mitochondrial Peroxiredoxin Annexin A5 Annexin A2 Aldolase A Fascin Pyruvate kinase VDAC-2 Stathmin Ran1BP GSTp ... Interestingly, in our model, dopamine induces an increase of the actin bundles regulator fascin [27] and discordant changes 4914 of two calcium-dependent, actin-associated proteins (annexins A2 and A5 ),...
Ngày tải lên: 15/02/2014, 01:20
Báo cáo hóa học: " Modulation of the major histocompatibility complex by neural stem cell-derived neurotrophic factors used for regenerative therapy in a rat model of stroke" ppt
... with an intra-peritoneal injection of 400 mg/kg chloral hydrate (Pharmaceutical Plant of Tiantan Hospital, Beijing, China) The rectal temperature was monitored and maintained at 37.5°C A scalp incision ... infarcted brain parenchyma of transplanted rats (A- iii and A- iv) A comparable extent of class II MHC was noted in ischemic rats irrespective of any therapy but unremarkable in normal rat (panel B, ... staining of Class II MHC was evident in the infarcted brain parenchyma (B-i), along the meninge (B-ii), areas near the ventricular lining and vascular wall near the hippocampus (B-iv) of transplanted...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx
... SEM) was determined In vivo toxicity studies Sera were collected from the treated animals to measure the biochemistry markers including alanine transaminase (ALT), aspartate aminotransferase (AST), ... deoxynecleotidyl transferasemediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; BUN: blood urea nitrogen; Cr: Creatinine Acknowledgements This work was ... LLC and A5 49 cell lines were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and maintained in 5% CO2 at 37°C in Dulbecco’s minimum essential medium (DMEM) containing...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: " Induction of Th1Immune responses following laser ablation in a murine model of colorectal liver metastase" potx
... 1: faint staining; 2: small amount or weak staining; 3: moderate staining; 4: abundant or strong staining; 5: Abundant or very strong staining Means for each group were determined using the individual ... primary colon carcinoma in the CBA mouse and maintained in vivo by serial passage in the flanks of CBA mice [18] For passage and experimentation, tumors grown subcutaneously were teased, passed ... treated/untreated tumor and normal liver tissues were examined Scoring criteria was used to estimate the amount and intensity of staining seen in each sample The grading system used was: as: 0: no staining...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "Combination immunotherapy and active-specific tumor cell vaccination augments anti-cancer immunity in a mouse model of gastric cancer" pdf
... Sato Y, Fujiwara T, Mine T, Shomura H, Homma S, Maeda Y, Tokunaga N, Ikeda Y, Ishihara Y, Yamada A, Tanaka N, Itoh K, Harada M, Todo S: Immunological evaluation of personalized peptide vaccination ... injected days before vaccination and tumor vaccinations were repeated every two weeks for a total of vaccinations In vitro T cell activation and expansion For T cell analyses, mice were vaccinated ... Nemunaitis J, Jahan T, Ross H, Sterman D, Richards D, Fox B, Jablons D, Aimi J, Lin A, Hege K: Phase 1/2 trial of autologous tumor mixed with an allogeneic GVAX vaccine in advanced-stage non-small-cell...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " Selective COX-2 inhibition prevents progressive dopamine neuron degeneration in a rat model of Parkinson''''s disease" potx
... neurons in hemiparkinsonian rats Brain Res 2004, 996:237-245 Adams FS, LaRosa FG, Kumar S, Edwards-Prasad J, Kentroti S, Vernadakis A, Freed CR, Prasad KN: Characterization and transplantation of ... (top panel) and 21 (bottom tracersdays measured6-OHDA lesion of dopamine terminal loss and inflammaA) Using A) Using micro-PET and selective radioactive tracers we measured in vivo the extent of ... microglia [28] and 11C CFT, a cocaine analog that binds to the DAT At 12 days we observed a decrease in CFT binding (~60% of contralateral BP) in the 6-OHDA lesioned striatum of both experimental groups...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Tumor necrosis factor-mediated inhibition of interleukin-18 in the brain: a clinical and experimental study in head-injured patients and in a murine model of closed head injury." pot
... time-point of maximal extent of intracerebral inflammation in the model of CHI used in this study [17] For assessment of intracerebral IL-18 levels, the murine brains were immediately removed after ... Dinarello CA, Novick D, Rubinstein M, Otto VI, Rancan M, Kossmann T, Redaelli CA, Trentz O, Shohami E, Stahel PF: Elevated intracranial IL-18 in humans and mice after traumatic brain injury and ... impairment in young people in industrialized countries [1,2] The neuropathological sequelae of brain injury are mediated in large part by a profound host-mediated intracranial inflammatory response...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Novel Aβ peptide immunogens modulate plaque pathology and inflammation in a murine model of Alzheimer''''s disease" potx
... beta antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer's disease Proc Natl Acad Sci U S A 2001, 98:8850-8855 Bacskai BJ, Kajdasz ... KS300 analysis program (Zeiss) Percentage of immunostained area (area of immunostaining/total image area × 100) was Page of 19 (page number not for citation purposes) Journal of Neuroinflammation ... panel) B Image analysis of thioflavine staining or CD45 immunoreactivity in cortex and hippocampus of animals untreated or immunized at 12–16 months Mean of each animal is the average of two sections...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Inhibition of NF-κB activation by 5-lipoxygenase inhibitors protects brain against injury in a rat model of focal cerebral ischemia" docx
... Justicia C, Camins A, Planas AM: Activation of nuclear factor-kappaB in the rat brain after transient focal ischemia Brain Res Mol Brain Res 1999, 65:61-69 Zhang W, Potrovita I, Tarabin V, Herrmann ... Schwaninger M: NF-kappaB is activated and promotes cell death in focal cerebral ischemia Nat Med 1999, 5:554-559 Rothwarf DM, Karin M: The NF-kappa B activation pathway: a paradigm in information ... 5'-ggaggaatgggagttgctgttgaa-3'; iNOS, forward primer, 5'ggaagaggaacaactactgctggt-3', reverse primer, 5'-gaactgagggtacatgctggagc-3' Thermal cycling conditions were as follows: activation of iTaq DNA polymerase at 95°C...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Oral administration of the KATP channel opener diazoxide ameliorates disease progression in a murine model of multiple sclerosis" ppt
... and quantify areas of axonal loss in the spinal cord of diazoxide-treated and vehicle-treated EAE mice Diazoxide-administered EAE mice showed a significant decrease in the percentage of axonal ... vehicle- and diazoxide-treated EAE mice (A) Quantification of silver staining of axons shows a decreased area of axonal loss in diazoxide-treated animals when compared to vehicle- EAE mice (B) ... oral administration of diazoxide constitutes an appropriate therapeutic approach for treating MS and other demyelinating diseases involving neuroinflammation and neurodegeneration Additional material...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " CD200-CD200R dysfunction exacerbates microglial activation and dopaminergic neurodegeneration in a rat model of Parkinson’s disease" pot
... were obtained from a rat brain atlas by Paxinos and Watson The injection was made at a rate of μl/ using a 10 μl Hamilton syringe with a 26-gauge needle At the end of each injection, the syringe ... were analyzed and each sample was analyzed in duplicate Statistical analysis Statistical analysis of the data was performed using GraphPad Prism version 5.00 for Windows (GraphPad Software, San ... Contralateral rotation measurements following administration of apomorphine in each experimental group are shown in bar graph at days and 21 days post-6-OHDA injection Data are presented as mean...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo khoa học: "Role of mucosal mast cells in visceral hypersensitivity in a rat model of irritable bowel syndrome" ppt
... Princeton Instrument, USA) Three sections per animal were examined and the number of MMC was counted in at least 10 randomly selected fields using an image analyzing software Loss of intracellular granules, ... receptor antagonist effectively reduced the mast cell activatorinduced visceral allodynia [8] In addition, it was also reported that experimental activation of proteinase-activated Role of mucosal mast ... rectal distension was quantified by scoring the abdominal withdrawal reflex (AWR), as described previously [17], and simultaneously measuring the concomitant increase in arterial pulse rate (tachycardia)...
Ngày tải lên: 07/08/2014, 18:20
Báo cáo khoa học: "Functional recovery and neural differentiation after transplantation of allogenic adipose-derived stem cells in a canine model of acute spinal cord injury" potx
... administration of propofol (Ha Na Pharm, Korea) at mg/kg Anesthesia was maintained by 2% isoflurane (Ilisung, Korea) in oxygen The minimum alveolar concentration was about 1.5 A multiparameter anesthetic ... Most dogs had mild vacuolar formations Cavitation of the gray matter was seen within cranial and caudal lesions of the SCI site Vacuolar formations and cavitation acted as a physical barrier to ... method was mechanical, whereas both mechanical and vascular factors were involved in balloon compression Transplantation of ASCs in spinal cord injury 279 Fig Images of the spinal cord injury...
Ngày tải lên: 07/08/2014, 23:22
Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps
... (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 (5'ATGGAGCTGCAAGGGGTGAG, 3'-CCCGTCACCTCCAATCCAAG), and ... specimen of the metatarsophalangeal (MTP) joint of a dehydroxymethylepoxyquinomicin (DHMEQ)treated mouse, showing almost normal findings, and (b) that of a control mouse showing remarkable cell infiltration ... Effect of DHMEQ on radiographic findings in collagen-induced arthritis in mice (a) A representative radiograph of the left metatarsophalangeal (MTP) joints of a mouse treated with dehydroxymethylepoxyquinomicin...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "The in vivo expression of actin/salt-resistant hyperactive DNase I inhibits the development of anti-ssDNA and anti-histone autoantibodies in a murine model of systemic lupus erythematosus" ppt
... samples was calculated based on a standard curve of recombinant bovine DNase I (SigmaAldrich) In addition to the standard assay buffer, optimised to generate maximal DNase activity, inhibitors of wild-type ... units (AEU) relative to a standard positive sample that was assigned a value of 100 AEU The data are presented as mean ± standard error of the mean Statistics were performed comparing autoantibody ... NaCl/ATP or NaCl/ATP/ Actin The level of DNase I activity in the supernatants was adjusted to give similar levels in the normal DNA-MG assay buffer (d) DNase I activity in the urine of actin-resistant,...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Gait analysis in a murine model of collagen-induced arthritis" ppsx
... progressively increased with increasing clinical scores in individual animals Values are means ± standard error of the mean (p < 0.05 versus baseline) acquisition of data and manuscript preparation MES and ... design, analysis and interpretation of data, and manuscript preparation JV contributed to study design, acquisition of data, analysis and interpretation of data, manuscript preparation, and statistical ... To date, the major examination in studies of CIA mouse models includes clinical symptoms as well as radiographic and histological assessments of arthritis Most of them are endpoint examinations,...
Ngày tải lên: 09/08/2014, 10:22