becoming a pro in sequence analysis

Tài liệu Báo cáo khoa học: Bacterial-induced hepoxilin A3 secretion as a pro-inflammatory mediator pptx

Tài liệu Báo cáo khoa học: Bacterial-induced hepoxilin A3 secretion as a pro-inflammatory mediator pptx

... SipA, promotes a lipid signal transduction cascade that recruits an ADP-ribosylation factor guanine nucleotide exchange factor (such as ARNO) to the apical plasma membrane ARNO facilitates ADP-ribosylation ... (P aeruginosa) leads to the activation of a unique lipid signal transduction cascade resulting in the up-regulation and activation of phosphorylated protein kinase C (pPKC), the signaling kinase ... Protein kinase Calpha-dependent increase in Ca2+-independent phospholipase A2 in membranes and arachidonic acid liberation in zymosan-stimulated macrophage-like P388D1 cells Biochem Pharmacol...

Ngày tải lên: 19/02/2014, 02:20

6 524 0
one more zero. how to trade the forex like a pro in one hour

one more zero. how to trade the forex like a pro in one hour

... dans cette table Australian Dollar $FXAU Brazilian Real $FXBR Canadian Dollar $FXCA Chinese Yuan $FXCN Denmark Krone $FXDK EMU Members Euro $FXEU Hong Kong Dollar $FXHK Indian Rupee $FXIN Japanese ... de l'antộrieur ộvaluer le bas de la barre avant une haute au-dessus de la haute de la barre antộrieure des prix 23 Merci M DeMark de partager cette information avec nous LACUNES Trouver jamais ... IDENTIFICATION D'EUX En regardant la semaine avant haute ou basse comme appui ou rộsistance, tu peut dộterminer de la prochain les niveaux principaux semaine, dont te donne une idộe oự regarder...

Ngày tải lên: 23/04/2014, 15:51

55 640 0
Báo cáo hóa học: " S1 gene sequence analysis of a nephropathogenic strain of avian infectious bronchitis virus in Egypt" docx

Báo cáo hóa học: " S1 gene sequence analysis of a nephropathogenic strain of avian infectious bronchitis virus in Egypt" docx

... ACGCCAGTTGTTAATTTGAAAACTGAACAAAAGACAGACTTAGTCTTTAATTTAATTAAGTGTGGTAAGTTACTGGTAAGAG Egypt/F/03 H120 M41 39 TGCACTATGTAGTGCTGTTTTGTATGACAGTAGTTCTTACGTGTACTACTATCAAAGTGCCTTCAGACCACCTAATGGTTGGCATTTACATGGGGGTGCTTATGCGGTAGTTAATATTTC ... .G G .A T M41 1201 G C G .A T.T Egypt/F/03 1239 TGAACCGCCAGTTATAACTCAACACAATTATAATAATATTACTTTAAATACTTGTGTTGATTATAATATATATGGCAGAACTGGCCAAGGTTTTATTACTAATGTAACCGACTCAGCTGT H120 ... TTCTGCTATGAAAAATGGCCAGTTTTTCTATAATTTAACAGTTAGTGTAGCTAAGTACCCTACTTTTAAATCATTTCAGTGTGTTAATAATTTAACATCCGTATATTTAAATGGTGATCT 399 C T 481 C Egypt/F/03 H120 M41 519 TGTTTACACCTCTAATGAGACCACAGATGTTACATCTGCAGGTGTTTATTTTAAAGCTGGTGGACCTATAACTTATAAAGTTATGAGAGAAGTTAAAGCCCTGGCTTATTTTGTTAATGG...

Ngày tải lên: 20/06/2014, 01:20

9 263 0
Báo cáo khoa học: " Sequence analysis of the S1 glycoprotein gene of infectious bronchitis viruses: identification of a novel phylogenetic group in Korea" docx

Báo cáo khoa học: " Sequence analysis of the S1 glycoprotein gene of infectious bronchitis viruses: identification of a novel phylogenetic group in Korea" docx

... (5'TG AAAACTGAACAAAAGAC3') together with one of the reverse primers S1OLIGO3' (CTAAACTAACATAAGGG C3') or degenerate3'-2 (5'CCATAAGTAACATAAGGG CAA3') [14,16] The RT reaction for synthesis of cDNA ... Vector (Promega, USA) and transformed into JM 109 competent cells (Promega, USA) The cells carrying recombinant plasmids were selected on Luria-Bertani agar plates containing ampicillin, X-gal and ... - Arkansas KM91‡ KM91 KM91 KM91 KM91 Variant KM91 Variant Variant Variant Variant GenBank accession numbers AY790368 AY790359 AY790360 AY790358 AY790362 AY790361 AY790366 AY790365 AY790363 AY790364...

Ngày tải lên: 07/08/2014, 20:23

7 298 1
Báo cáo khoa học:" Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pptx

Báo cáo khoa học:" Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pptx

... Isaeva EI, Konakova TE, Thoidis G, Piskareva LM, Akopova II, Kartashov A, Altstein AD, Ilyinskii PO, Shneider AM: Protection against mouse and avian influenza A strains via vaccination with a ... new HA and/or NA subtype into human population All known HA and NA subtypes are maintained in avian species, and all mammalian influenza A viruses are thought to be derived from the avian influenza ... of human and avian influenza A virus are shown The major variable is defined as amino acid variants which are found in 10% or more strains Different sites are shaded in red Page of 13 (page number...

Ngày tải lên: 12/08/2014, 04:21

13 343 0
Báo cáo khoa học: " In vitro analysis of expression vectors for DNA vaccination of horses: the effect of a Kozak sequence" docx

Báo cáo khoa học: " In vitro analysis of expression vectors for DNA vaccination of horses: the effect of a Kozak sequence" docx

... amplified using 5'-GGTATGCGGCCGCTTATGAAGTGGGTAACCTTTAT-3' without Kozak or using 5'-GTATGCGGCCGCCACCATGAAGTGGGTAACCTTTAT-3' with Kozak sequence and 5'CGCTAGGATCCAATCAATGGTGATGGTGATGATG-3' Taq DNA Polymerase ... EcoRI and XhoI and ligated with T4 DNA ligase into pcDNA3.1/V5-His (Invitrogen) (H1) The gene was amplified using primers 5'-GGTGTGAATTCCATGAAGTGGGTAACCTTTAT-3' and 5'-GGTGTCTCGAGCGTAAGCCTAAGGCAGCTTGA-3' ... semi Kozak sequences are shown with capital letters Page of (page number not for citation purposes) Acta Veterinaria Scandinavica 2008, 50:44 with BamHI and HindIII (Fermentas) and ligated into...

Ngày tải lên: 12/08/2014, 18:22

7 381 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 17)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 17)

... transformation in rats J Pharm Sci 74:780–782 10) Kielbasa WB, Bauer JA, Fung HL (1999) Analysis of isobutyl nitrite inhalant in rat and human blood: application for pharmacokinetic investigations J Chromatogr ... principle, the sampling, extraction and GC analysis should be made at low temperature, in a gastight state and in a short time This method is applicable to other biomedical specimens and drinks/foods ... concentration of an alkyl nitrite on the horizontal axis and peak area on the vertical axis The concentration of the analyte in a specimen is calculated using the calibration curve i Assessment and some...

Ngày tải lên: 18/10/2013, 00:15

6 581 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 67)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 67)

... GC/MS analysis for EMPA in serum (a) a TIC and mass chromatograms; (b) an EI mass spectrum of the t-BDMS derivative of EMPA; (c) a CI mass spectrum of the same derivative of EMPA data of animals According ... remains, there is a danger of the secondary exposure for an analyst; the manipulations including the above evaporation should be done inside a draft chamber f) For quantitative analysis of DAEMS, ... axis and DAEMS concentration on the horizontal axis A peak area ratio obtained from a test specimen is applied to the calibration curve to calculate a DAEMS concentration g) For deproteinization,...

Ngày tải lên: 18/10/2013, 00:15

9 549 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 20)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 20)

... Yokoyama M, Okada Y, Suzuki K (1992) Determination of cannabinoids in cannabis oil by capillary gas chromatography Eisei Kagaku 38:471–475 (in Japanese with an English abstract) 5) Watanabe K, Yamaki ... construct a calibration curve with cannabinoid concentration on the horizontal axis and with peak area ratio of a cannabinoid to IS on the vertical axis GC analysis of cannabinoids in plant specimens ... 188 Cannabinoids and their metabolites GC analysis of cannabinoids in plant specimensa Reagents and their preparation • • • Extraction and purification of cannabinoids [3]: Cannabis sativa L is...

Ngày tải lên: 24/10/2013, 19:15

8 510 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 21)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 21)

... not, an appropriate amount of the above buffer solution is added to it The blank urine and calibration samples are processed in the same way These samples are equally treated according to the above ... Hasegawa M, Maseda C, Kagawa M et al (1992) Morphine and codeine being contained in poppy seeds and poppy seed-containing foods Eisei Kagaku 38:192–195 (in Japanese with an English abstract) 11) ... that an amount of codeine comparable to that of morphine are also included in the poppy seed- containing foods [10] The half-life of heroin disappearance in human body was reported to be only about...

Ngày tải lên: 24/10/2013, 19:15

12 480 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 70)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 70)

... normal cyanosis headache, dyspnea, tachypnea, tachycardia and hypertension mental derangement, listlessness and metabolic acidosis coma, convulsive attack and hypotension death A poisoning case ... oxidation of nitrite into nitrate and the same extractions as those for nitrate A calibration curve for nitrite using blank specimens and IS is also prepared for quantitation in the same way Assessment ... [4] An unidentified male was found naked from the waist up in a park at about 10:00 p m.; he was suffering from some difficulty in breathing He was sent to a nearby clinic and diagnosed as exsiccosis;...

Ngày tải lên: 24/10/2013, 19:15

6 489 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 71 and End)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 71 and End)

... 285, 290 alternative specimens Amanita neoovoidea 480 Amanita pantherina 469 Amanita phalloides 469 Amanita verna 469, 474 Amanita virosa 469, 473 amanitin 473, 477, 479 amido-type local anesthetic ... 635 inorganic nitrite 649 inorganic poisons 637 interface 40 International Normalized Ratio 605 intratracheal contents 168 intratracheal gas 161, 162 in vitro interval 218 iodoplatinate reagent ... aldicarb 566 aldrin 529 alkylated adducts 85 alkylated DNAs 85 alkylation 30 alkyl nitrites 153, 655 allobarbital 305, 308 allylesterase 624 allyxycarb 566 alminoprofen 325, 330, 332 alprazolam...

Ngày tải lên: 24/10/2013, 19:15

17 564 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 22)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 22)

... cocaine was reported to be 5.9 on average for urine sampled 0–1 h after cocaine inhalation; the ratio was 10.6 on average for urine sampled 0–8 h after the inhalation The ratios increased according ... Significance and problems of doping tests and toxin analysis Nipponrinsho 57:361–363 (in Japanese) 10) Sander R, Ryser MA, Lamoreaux TC et al (1985) An epidemic of cocaine associated deaths in Utah ... vitro interval (period between sampling and analysis) are variable; the hydrolytic rate of cocaine shows great variation Usually, the metabolism, metabolite accumulation and excretion for cocaine...

Ngày tải lên: 29/10/2013, 01:15

12 479 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 23)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 23)

... concentration in the horizontal axis and peak area ratio of pentazocine to IS in the vertical axis The peak area ratio of a test specimen is applied to the calibration curve to obtain its pentazocine ... plasma by high performance liquid chromatography Pharmazie 46:464–465 8) Seno H, Kumazawa T, Ishii A et al (2000) Determination of pentazocine in human whole blood and urine by gas chromatography/surface ... phencyclidine in human plasma using capillary gas chromatography Method Find Exp Clin Pharmacol 12:193–196 4) Hattori H, Suzuki O, Seno H et al (1993) Sensitive determination of pentazocine in whole...

Ngày tải lên: 29/10/2013, 02:15

5 429 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 24)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 24)

... 108–109 (in Japanese) 2) The Pharmaceutical Society of Japan (ed) (1992) Standard Methods of Chemical Analysis in Poisoning – With Commentary – Nanzando, Tokyo, p 43 and p 151 (in Japanese) 3) ... combined chloroform extract is evaporated to dryness; the residue is dissolved in a small amount of methanol to be subjected to further analysis TLC analysis Analytical conditions TLC plate: a ... EI mass spectrum of LSD is shown in > Fig 6.1 The molecular ion appears as the base peak Fragment peaks can be observed at m/z 221, 207, 181 and 167 The fragmentation pathways are shown in >...

Ngày tải lên: 08/11/2013, 01:15

4 465 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 25)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 25)

... derivatization method J Chromatogr 467:227–235 24) Tsuchihashi H, Nakajima K, Nishikawa M et al (1991) Determination of methamphetamine and amphetamine in urine by headspace gas chromatography/mass ... MDEA=3,4-methylenedioxyethylamphetamine; MA=methamphetamine; AP=amphetamine 235 236 3,4-Methylenedioxyamphetamines ⊡ Figure 7.5 Mass spectra of TFA-derivatives of MDMA, MDA, HMMA and HMA extracted from an MDMA addict’s urine Detailed ... urinary MDAs recommended by the Substance Abuse and Mental Health Services Administration (SAMHSA) is 250 ng/mL Symptoms, and toxic and fatal concentrations MDMA causes increased catecholamine...

Ngày tải lên: 08/11/2013, 01:15

11 511 0
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 26)

Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 26)

... Lee LF, Halzhauer LB et al (2001) Analysis of urine samples in cases of alleged sexual assault: case history In: Salamore SJ (ed) Benzodiazepines and GHB: Detection and Pharmacology Humana Press, ... responding verbally; the levels of serum creatinin kinase and aspartate aminotransferase were more than 100-times the normal limits On hospital day 2, he became rigid, diaphoretic and had a temperature ... human body fluids by headspace solid-phase microextraction (SPME) Chromatographia 43:331–333 14) Nakahara Y, Takahashi K, Sakamoto T et al (1997) Hair analysis for drugs of abuse X VII Simultaneous...

Ngày tải lên: 08/11/2013, 01:15

12 496 0
Tài liệu Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 27) ppt

Tài liệu Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 27) ppt

... LC/MS analysis [8] See [8] Reagents and their preparation i Reagents Prochlorperazine, trifluoperazine, perphenazine, fluphenazine, propericiazine and thioridazine can be purchased from Sigma (St ... Louis, MO, USA) Pure powder of perazine and clospirazine was donated by Mitsubishi Welpharma, Osaka, Japan; that of flupentixol by Takeda Chem Ind Ltd., Osaka, Japan; that of thioproperazine by Shionogi ... Geraut A, Kintz P, Traqui A et al (1994) Toxicological findings in a fatality involving chlorpromazine Bull Int Assoc Forensic Toxicol 24 (2):27–30 4) Kintz P, Berthault F, Traqui A et al (1995) A...

Ngày tải lên: 15/12/2013, 12:15

7 458 0
w