... 't.,"U ... Μ." (JΡ,.', ...
Ngày tải lên: 14/05/2014, 10:23
... the transcription initiation site a TATA- like sequence (TAAATA) is located between base pairs )28 and )23. A CCAAT-consensus box is located at )86 bp (CCAAT), a reverse CCAAT motif lies at )825 ... stranded oligonucleotides spanning the region from )70 to )36 of t he xMGP promoter (5Â-GATCCAGGGGAGGGAAAACAAGGA GATGAGGAGGTGTGGT-3Â,and5Â-GATCTACCA CACCTCCTCATCTCCTTGTTTTCCCTCCCCTG-3Â) as BamHI/BglII ... constructs )180/)36TATALUC and )180/)72TATALUC were gen- erated by PCR amplification with a common, sense oligonucleotide ( 5Â-CG GGATCCCAATCTGTTGCTAA TTAGG-3Â)andthe3Â specic oligonucleotides (5Â-GA AGATCTACCACACCTCCTCATCTCC-3Â)...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... of action; peptide–membrane interaction; proteomics Correspondence M. L. Mangoni, Unita ` di Diagnostica Molecolare Avanzata, II Facolta ` di Medicina e Chirurgia, Azienda Ospedaliera S. Andrea, via ... fluorescein isothiocyanate–dextran of 4 kDa average molecular mass; FITC-D 10, fluorescein isothiocyanate–dextran of 10 kDa average molecular mass; FITC-D 40, fluorescein isothiocyanate–dextran of 40 kDa average ... Universita ` di Roma Tor Vergata, Rome, Italy 4 Dipartimento di Biologia di Base ed Applicata, Universita ` de L’Aquila, Italy Keywords frog skin antimicrobial peptides; Gram-negative bacteria; mode...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: A novel, promoter-based, target-specific assay identifies 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx
... synthase gene; Gb4, globotetraosylceramide (GalNAcb1,3Gala1,4LacCer); GD 1a, NeuAca2,3Galb1,3GalNAcb1,4(NeuAca2,3)LacCer; GD1b, Galb1,3GalNAcb1,4(NeuAca2,8NeuAca2,3)LacCer; GM1, Galb1,3GalNAcb1,4 (NeuAca2,3)LacCer; ... Ishii A, Ohta M, Watanabe Y, Matsuda K, Ishiyama K, Sakoe K, Nakamura M, Inokuchi J, Sanai Y & Saito M (1998) Expression cloning and functional char- acterization of human cDNA for ganglioside ... Function Analysis Team, Health Technology Research Center, National Institute of Advanced Industrial Science and Technology (AIST), 2217-14 Hayashi, Takamatsu, Kagawa 761-0395, Japan Fax: +81...
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: An antimicrobial peptide tachyplesin acts as a secondary secretagogue and amplifies lipopolysaccharide-induced hemocyte exocytosis potx
... 276, 27166–27170. 26 Kawabata S, Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, a small granular com- ponent in horseshoe crab hemocytes, ... lipid A analogues and acidic phospholipids. Eur J Biochem 176, 89–94. 21 Nakamura T, Furunaka H, Miyata T, Tokunaga F, Muta T & Iwanaga S (1988) Tachyplesin, a class of antimicrobial peptide ... An antimicrobial peptide tachyplesin acts as a secondary secretagogue and amplifies lipopolysaccharide-induced hemocyte exocytosis Aya Ozaki 1 , Shigeru Ariki 1 and Shun-ichiro Kawabata Department...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo Y học: A single charged surface residue modifies the activity of ikitoxin, a beta-type Na+ channel toxin from Parabuthus transvaalicus doc
... ikitoxin, a beta-type Na + channel toxin from Parabuthus transvaalicus A. Bora Inceoglu 1, *, Yuki Hayashida 2 , Jozsef Lango 3 , Andrew T. Ishida 2 and Bruce D. Hammock 1 1 Department of Entomology and ... software for mutation, energy minimization and electrochemical surface calculation. RESULTS The separation obtained on the magic bullet C4 column was identical to that obtained on a Vydac analytical ... against insects was tested by injecting blowfly and cabbage looper larvae. All animal care and experimental protocols conformed to the guidelines of the Animal Use and Care Administrative Advisory Committee...
Ngày tải lên: 31/03/2014, 08:20
pease, r. a. (1991) troubleshooting analog circuits
... Problem Area A few years ago we had so many nagging little troubles with band-gap reference circuits at National, that I decided (unilaterally) to declare myself “Czar of Band Gaps.” The main ... equipment that you may find useful. Logic analyzers, impedance analyzers, spectrum analyzers, program- mable current pumps, capacitance meters and testers, and pulse generators can all ease various ... than a DVM? Well, the analog voltmeter usually has inferior accuracy and resolution, but when you watch an ordinary analog voltmeter your eye can detect a trend or rate-of-change that may...
Ngày tải lên: 18/04/2014, 12:24