athreshold for t cell function

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... target organ may disturb the positive feedback loop that controls Foxp3 stability, such that Treg cells convert to Teff cells with a high diabetic potential Moreover, Komatsu et al noted that ... cell transplantation (HSCT) Studies in such patients indicate that Treg cells increase in response to the treatment, and that this effect seems to be increased with prolonged time of treatment [66] ... not mimic, at least reflect events ongoing at the specific site of inflammation Whether or not those events that are translated into the blood encompass autoantigenspecific Treg cell defects...

Ngày tải lên: 18/06/2014, 16:20

12 581 0
Báo cáo sinh học: " Systematic identification of regulatory proteins critical for T -cell activation" doc

Báo cáo sinh học: " Systematic identification of regulatory proteins critical for T -cell activation" doc

... vectors [48,50] BstXTRA5G: 5؅-TTGCAGAACCACCACCTTGGGCTCTTAACCTAGGCCGATC-3؅ BstXTRA3D: 5؅-TTGCAGAACCAATTTAATGGCGGCCAGTCAGGCCATCGTCG-3؅ RT-PCR cloning was achieved with kits from Clontech (Palo Alto, ... sorters (MoFlo) after stimulation and staining with antiCD69-APC and anti-CD3-PE The sort gate was set at the equivalent of 1% of satellite control cells that were stimulated but never flow-sorted ... (N+C)-IRES-GFP, cells were cultured without (top panels) or with (bottom panels) Dox for days, and then left unstimulated or stimulated with anti-TCR antibody for 24 h The box R1 indicates GFP-positive cells...

Ngày tải lên: 06/08/2014, 18:20

16 316 0
Báo cáo y học: "Defective CD4+CD25+ regulatory T cell functioning in collagen-induced arthritis: an important factor in pathogenesis, counter-regulated by endogenous IFN-γ" potx

Báo cáo y học: "Defective CD4+CD25+ regulatory T cell functioning in collagen-induced arthritis: an important factor in pathogenesis, counter-regulated by endogenous IFN-γ" potx

... AAC CTT; Foxp3-RV, TTC TCA CAA CCA GGC CAC TTG; Foxp3-TP, ATC CTA CCC ACT GCT GGC AAA TGG AGT C; TGF-β-FW, TGA CGT CAC TGG AGT TGT ACG G; TGF-β-RV, GGT TCA TGT CAT GGA TGG TGC; TGFβ-TP, TTC AGC ... unable to downregulate the activity of wild-type Treg cells acting on wild-type Teff cells We therefore conclude that the in vivo effect of endogenous IFN-γ that accounts for the greater suppressive ... the effect of IFN-γ on Treg cell activity is exerted in part via ACs Competing interests The author(s) declare that they have no competing interests Authors' contributions BDK, HK and TM performed...

Ngày tải lên: 09/08/2014, 06:22

14 404 0
Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

... addition to the TLR agonists that are innate immunity ligands, the immune response involves two adaptive immunity ligands that are expressed on activated T cells and bind to non-TLR receptors ... allowed to clot at room temperature for 15 minutes Samples were centrifuged at 1,500 g at about 4°C for 10 minutes and the serum was aliquoted and stored in airtight stoppered polypropylene tubes at ... that, even at this early time point, both IMP321 recipients who had seroconverted after the second immunization in the μg group had attained seroprotective titers Following the third immunization,...

Ngày tải lên: 11/08/2014, 10:23

15 331 0
Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot

Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot

... attenuates the response (top) The newly proposed model puts together new insights into CTLA-4 functions (bottom) (1) During suboptimal T cell activation, CTLA-4 sets the threshold for activation ... of three distinct functions of CTLA-4 that might be relevant under different circumstances (Fig 2) First, CTLA-4 sets the threshold for T cell activation, and thus probably contributes to maintenance ... simultaneously (Fig 2) Multiple -function model for cytotoxic T- lymphocyte antigen-4 (CTLA-4) The traditional view of the function of CTLA-4 is that it is upregulated upon stimulation of the T cells...

Ngày tải lên: 09/08/2014, 01:23

10 397 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTG CAAAGCGATCTTATTCTTTT AGCGTAATCTGGAACGTC ACTACGTATCACGACAAACCAACAGCCG ... GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGC ... ACTACGTATCACGACAAACCAACAGCCG TCAGGAACATCGTATGGGTA CATTATTGGAATGAGGAAA ATGACGTTCCAGATTACGCT AAAAGAATAAGATCGCTT TTACCGGTACTATTTTTGTTCCTCAAACTAGGAG GTATGACCACATTCTATACTGAGAAGAGTGCCTATATAAATCATCGTCAGGTAAAGAGCCCCATTATCTT GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG...

Ngày tải lên: 18/02/2014, 06:20

15 476 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

... hypothesis that the b-turn structures are important for the inhibitory activities of the peptides, the structures of the cyclic peptides were determined by NMR The results proved that the stable ... different concentrations studied These peptides were also tested for their toxicity using the MTT assay [17] All the four peptides tested in the study resulted in 90–100% viability indicating that these ... If the ˚ rmsd of a structure is less than A compared to the lowest energy structure in that starting position, that was grouped together with the lowest energy structure forming a cluster of structure...

Ngày tải lên: 19/02/2014, 13:20

14 660 0
báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx

... NK cells initially-obtained their name due to their natural cytotoxicity against tumor cells requiring no prior sensitization, unlike T cells [4] It is well established that the cytotoxicity ... Interestingly, we noticed that these receptors are linked to some extent to T cell proliferation as anti-CD3/CD28 activated T cells have a significantly lower Kd than resting autologous T cells ... cytotoxic against the K562 cell line and that 3a-G1 doesn 't affect their cytotoxicity when compared with untreated cells [see Additional file 1] Contrary to expectation, we could not demonstrate...

Ngày tải lên: 18/06/2014, 15:20

13 406 0
Báo cáo hóa học: " Strategy Escalation: An emerging paradigm for safe clinical development of T cell gene therapies Richard Paul Junghan" pdf

Báo cáo hóa học: " Strategy Escalation: An emerging paradigm for safe clinical development of T cell gene therapies Richard Paul Junghan" pdf

... from the current state of the art for designer T cell therapies, counseling against the most intensive Strategies for untested antigen targets If by an early Strategy, the patient can safely be treated, ... designer T cells infused after conditioning This was the first-inhuman designer T cell test against this target (0 → Strategy test) The patient experienced acute pulmonary edema within the first hour ... [11,17], it is likely that a reasonable Strategy Escalation increment to a starting test with 109 T cell engrafted is not preceded by a test of 109 T cells infused, but by a test of 1011 T cells...

Ngày tải lên: 18/06/2014, 16:20

8 474 0
Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot

Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot

... stimulated cells/expansion by matched control cells and plotted this as a function of the time interval between first and second stimulation (Figure 8A-D) These plots make two important points ... matched control cells also often expanded as well To distinguish true restimulation-dependent growth from persistent expansion still attributable to primary stimulation, we calculated the ratio ... in practical applications it is the ability of any given method to expand functionally active, antigen-specific T cells directed against a defined target pathogen or tumor that is most critical...

Ngày tải lên: 18/06/2014, 16:20

15 503 0
báo cáo hóa học: " Persistently elevated T cell interferon-γ responses after treatment for latent tuberculosis infection among health care workers in India: a preliminary report" pot

báo cáo hóa học: " Persistently elevated T cell interferon-γ responses after treatment for latent tuberculosis infection among health care workers in India: a preliminary report" pot

... underwent a follow-up QFT-G These students underwent a third QFT-G in July 2005, 10 months after treatment Of the 22 students, 10 students were TST and QFT-G positive at baseline (i.e TST+/QFT-G+), ... after active TB treatment [36-39], it is plausible that INH treatment might decrease IFN-γ responses In contrast to active TB, the kinetics of T cell responses during LTBI treatment has not been ... baseline, of the 726 HCWs, 68% reported having had at least one direct contact with a patient with TB (direct contact was defined as contact between two people that is of sufficient distance to allow...

Ngày tải lên: 20/06/2014, 00:20

7 495 0
Báo cáo y học: " Chitosan Interferon-c Nanogene Therapy for Lung Disease: Modulation of T-Cell and Dendritic Cell Immune Responses" pps

Báo cáo y học: " Chitosan Interferon-c Nanogene Therapy for Lung Disease: Modulation of T-Cell and Dendritic Cell Immune Responses" pps

... populations support the hypothesis that CD8+ T cells are important in allergen-induced lung pathology and that at least a part of the protective effect of CIN treatment can be attributed to a ... consistent with the other data in supporting the idea that CIN treatment decreases the inflammatory response to an allergen by inhibiting dendritic cell activation of OVA-specific T cells Alteration ... Dendritic cells are the predominant antigen-presenting species in regulating Tcell activation and thus may participate in the protective effect of CIN therapy To determine whether CIN therapy...

Ngày tải lên: 08/08/2014, 21:20

11 486 0
Báo cáo y học: " Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" docx

Báo cáo y học: " Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" docx

... synovium The essential factor in this situation appears to be the T cell- monocyte interaction to the extent that T- cell isolation renders the cells sensitive to apoptosis, while coculture of T cells ... cellular interaction are essential for the induction of the T- cell apoptosis-resistant phenotype To further investigate the mechanism responsible for the resistance of T cells to glucocorticoid-induced ... recruited the patients for the study, performed arthroscopies, and participated in acquisition and interpretation of the data OS participated in the flow cytometry experiments CG participated in...

Ngày tải lên: 09/08/2014, 01:22

9 304 0
Báo cáo y học: "T-cell contact-dependent regulation of CC and CXC chemokine production in monocytes through differential involvement of NFκB: implications for rheumatoid arthritis" docx

Báo cáo y học: "T-cell contact-dependent regulation of CC and CXC chemokine production in monocytes through differential involvement of NFκB: implications for rheumatoid arthritis" docx

... similarities in their effector function to Tck cells, rather than Ttcr cells It is noteworthy that RA T cells isolated based on CD2 expression have previously demonstrated an identical effector function ... synthesis in RA synovial cultures [23] We previously reported that the contact-dependent effector function of RA T cells in the joint is identical to that displayed by bystander-activated T cells ... following stimulation with (b) Ttcr cells and (c) Tck cells Data represent the mean of triplicate cultures ± standard deviation and are representative of at least three experiments Statistically...

Ngày tải lên: 09/08/2014, 08:23

10 456 0
Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx

Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx

... at that position were barely recognized by the T cells It is plausible that the primary amine at ε position participates in electrostatic interactions with negatively charged residues of the TCR ... encephalomyelitis [27] revealed that there were few specific contacts between the TCR CDR3 loops and the cognate peptide Competing interests The authors declare that they have no competing interests the ... interests the collaboration of the staff of the Central Cytometry Laboratory in the Cochin Institute This work was supported by institutional grants from Institut National de la Santé et de la Recherche...

Ngày tải lên: 09/08/2014, 10:21

9 318 0
Báo cáo y học: "Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" pdf

Báo cáo y học: "Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" pdf

... synovium The essential factor in this situation appears to be the T cell- monocyte interaction to the extent that T- cell isolation renders the cells sensitive to apoptosis, while coculture of T cells ... cellular interaction are essential for the induction of the T- cell apoptosis-resistant phenotype To further investigate the mechanism responsible for the resistance of T cells to glucocorticoid-induced ... recruited the patients for the study, performed arthroscopies, and participated in acquisition and interpretation of the data OS participated in the flow cytometry experiments CG participated in...

Ngày tải lên: 09/08/2014, 13:22

9 397 0
Báo cáo y học: "Apoptotic cell-mediated suppression of streptococcal cell wall-induced arthritis is associated with alteration of macrophage function and local regulatory T-cell increase: a potential cell-based therapy" ppsx

Báo cáo y học: "Apoptotic cell-mediated suppression of streptococcal cell wall-induced arthritis is associated with alteration of macrophage function and local regulatory T-cell increase: a potential cell-based therapy" ppsx

... apoptotic cells seemed to be less efficient to induce and sustain SCW inflammation Indeed, apoptotic cell injection acts in two different ways First, apoptotic cells together with phagocytes that ... right panel) Co-injection of apoptotic cells to SCW therefore reduced SCW-induced macrophage activation in vivo This reduction of activation may be related to apoptotic cell uptake Apoptotic cell ... prevent effector T- cell activation and migration to inflammatory sites such as joints and bones The apoptotic cell injectioninduced TGFβ increase also correlates with the Treg increase Then, after...

Ngày tải lên: 09/08/2014, 14:22

8 310 0
Báo cáo y học: "Comparison of capillary based microflurometric assay for CD4+ T cell count estimation with dual platform Flow cytometr" pps

Báo cáo y học: "Comparison of capillary based microflurometric assay for CD4+ T cell count estimation with dual platform Flow cytometr" pps

... uses T cell gating strategy to gate CD3+ cells and estimates CD3+CD4+ cells The gating on CD3+ T cells removes the monocytes (expressing CD4 but not CD3 on their cell surface) from the gate The ... System does not prescribe validity criteria for assessing the formation of the gate This was found to be extremely critical for reliable gating for accurate estimation of CD4+ T cell counts, to ... correlation test and the degree of agreement was estimated by calculating the kappa factor The Bland-Altman plots were generated for assessment of the variation between the two methods The sensitivity...

Ngày tải lên: 10/08/2014, 05:20

7 462 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

... sample Telomere length estimation The telomere length assay is based on the method by Cawthon et al[33] Briefly, commercially obtained telomere specific primers; CGGTTTGTTTGGGTTTGG GTTTGGGTTTGGGTTTGGGTT ... GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT (reverse), were used to amplify telomeric DNA in the CD4+ and CD8+ T cell subset Six serial dilutions of standards containing telomeric ... sjTREC/100 T cells For the T cell repertoire analysis, the Kolmogorov Smirnov test was used to assess variation in the distribution of T cell clones within the population For the season of birth...

Ngày tải lên: 10/08/2014, 05:21

11 527 0
báo cáo khoa học: "Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic myeloid leukemia" pot

báo cáo khoa học: "Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic myeloid leukemia" pot

... interesting to detect the evolution of T- cell clonality in the patient at different disease status The features of restrictive usage and absence of partial T cell clones could be found in patients ... the present study, we characterized the T- cell repertoires between the stages of CML-CP and Ph- negative ALL Our previous studies showed that the clonally expanded T cells were associated with ... It has been reported that leukemia-associated antigen can induce specific clonal expansion of host T- cells or the allogeneic T- cells These activated T- cells have been shown to display potential...

Ngày tải lên: 10/08/2014, 22:21

7 324 0
w