... on the stability of the data in the segment Unfortunately, the stability cannot be predicted without knowing future access patterns Using an assumption that the older the data in a segment the ... the log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is ... result in small random disk I/Os, and the creation and deletion times for such files are often dominated by updates to file system ‘‘metadata’’ (the data structures used to locate the attributes and...
Ngày tải lên: 12/09/2012, 15:05
... the optout clause pertaining to the latter Thus, the Report does not bring out that the Soviet abstention from the votes on the voluntary moratorium in 1983 makes it very hard to argue that this ... 1994 (START I Treaty); and the Treaty on Further Reduction and Limitation of Strategic Offensive Arms, Moscow, January 1993 (START II Treaty) Report to the Storting, St.meld 34 (1993–94), Atomvirksomhet ... designated national authority to be reported to the secretariat of the Convention,17 located with the International Maritime Organisation (IMO) Members are obliged to monitor and keep a record of the...
Ngày tải lên: 01/11/2013, 09:20
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf
... Care at the Demonstration and Control MTFs, Study Years One and Two 104 5.4 Estimated Costs of Outpatient, Inpatient, and Total Services for Asthma Patient MTF Enrollees at the Demonstration ... participants at some of the MTFs still thought that use of the forms was mandatory Other sites chose not to use the forms, but they did not apply alternative methods to ensure that asthma diagnosis and ... “guideline champion” at each facility to lead the implementation process, a facilitator to coordinate the MTF’s implementation activities, and an implementation team with representatives from the various...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu REPORT BY THE DIRECTOR-GENERAL ON THE UNITED NATIONS DECADE OF EDUCATION FOR SUSTAINABLE DEVELOPMENT: INTERNATIONAL IMPLEMENTATION SCHEME AND UNESCO’S CONTRIBUTION TO THE IMPLEMENTATION OF THE DECADE doc
... realized that the widespread growth of environmental degradation needed international attention and collaboration rather than national approaches and solutions While some attention was attached to the ... consultations with other United Nations agencies, with Member States and with civil society and NGOs with a view to facilitating the smooth implementation of the Decade of Education for Sustainable ... effectiveness B Putting the seven strategies into practice Table was created to assist nations to incorporate the seven strategies described above into the process to create an implementation...
Ngày tải lên: 21/02/2014, 17:20
Implementation of the Waste Electric and Electronic Equipment Directive in the EU pot
... implementation of the Directive by the Member States and to obtain feedback on potential areas for revision The review of the implementation of the WEEE Directive in EU Member States on which this ... reuse/recycling targets unless the exporter can prove that the waste treatment methods used meet the requirements of the Directive The Directive also specifies many substances and components that must be ... * Target to be set by December 31, 2008 WEEE Directive WEEE Directive – Current State of Implementation 2.1 State of Directive Transposition and Implementation in EU 25 The transposition of the...
Ngày tải lên: 08/03/2014, 13:20
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh
... Another point is that teachers should ask students to come to the front of class before telling them the situation then give them few minutes to think about that Thanks to this, students will speak ... rich That‟s why their lectures don t attract students‟ attention ant it appears quite boring to the students Furthermore, with difficult lessons, teachers don t know how to make students understand ... Quang Ninh Thirdly, the study investigates the students and teachers‟ attitude toward a speaking lesson The last also the most important aim is to suggest some effective activities that can be...
Ngày tải lên: 15/03/2014, 10:03
The Design and Implementation of a Sequence Database System * docx
... sourcesof such information: one is from selectionpredicates in thequery that usethe position attribute Experiment demonstrates the benefitsof propagatingsuch selectionsinto the sequencescans The other ... is almost the sameas in the atstart experiment, because it is able to use the selection information to position the scanat the appropriatestart position On the other hand, ORDPD cannot 121 BPPD- ... execution time Notice that while the cost of the default SEQ execution with pipelining grows moderately (due to the presenceof more operatorson the query execution path), the cost of the materialized...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
... stimulation was also investigated This was the tyrosine phosphorylation of STAT3/STAT5, monitored through binding of anti-(phospho-tyr-STAT3/STAT5) Ig As Fig 5B shows, stimulation of the Kit225K6 ... orientation of IL-2R subunits seems essential to docking and activation of STATs, we investigated here whether raft integrity is a necessary condition to a proper transduction of cytokine-stimulated ... MA, USA) These antibodies detect nonphosphorylated and phosphorylated Tyr moieties on STAT3/STAT5, respectively, without appreciable cross-reaction with other Tyr-phosphorylated STATs After washing,...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo khoa học: Reaction mechanisms of thiamin diphosphate enzymes: defining states of ionization and tautomerization of the cofactor at individual steps docx
... enzymes, and the information that has emerged regarding the state of ionization and tautomerization of the AP ring on these intermediates Understanding these issues is important with respect to monitoring ... presence of the conjugate base in the activated or unactivated forms of YPDC [51] It is important to emphasize that determination of the state of ionization and tautomerization of enzymebound ThDP by ... cation radical There is no evidence yet regarding their state of tautomerization ⁄ protonation 2442 Assignment of the state of ionization and tautomerization to each intermediate on the pathway Perhaps...
Ngày tải lên: 29/03/2014, 23:20
Báo cáo khoa học: Regulation of the muscle-specific AMP-activated protein kinase a2b2c3 complexes by AMP and implications of the mutations in the c3-subunit for the AMP dependence of the enzyme docx
... although we have to acknowledge that the semiquantitative nature of the western blot technique makes the exact measurement difficult It is noteworthy that for the mutations in the N-terminal Bateman ... order to study the effect of the mutations within AMPK c3 on the activity of the enzyme, we introduced several missense mutations into the c3 gene (Fig 2), and investigated the effect of these ... 2888 mutation in c3 is equivalent to the R302Q substitution in c2, the dominant isoform of the c-subunit in the heart The R302Q mutation, together with several other substitutions identified in...
Ngày tải lên: 30/03/2014, 08:20
Master Program Applied Economics at the Faculty of Economics and Statistics of the University of Innsbruck ppt
... Requirement for the admission to the module is the positive assessment of the thesis § Master thesis (1) The completion of a Master thesis is mandatory (2) The Master thesis has to meet the scientific ... student enrolled in the program is allotted a quota of twice 1000 points at the beginning of the registration period of the respective semester This quota expires at the end of the registration ... topic of their Master thesis themselves or choose their topic from a list of proposals (4) The Master thesis equals 27.5 ECTS-credit points (5) The written announcement of both the topic and the supervising...
Ngày tải lên: 31/03/2014, 03:20
iec 61131-8 programmable controllers - guidelines for the application and implementation of programming languages
... be determined at any point in time as the set of active steps and actions Without this representation, the state of the system must be inferred from data such as system inputs, outputs, and some ... according to the time of day, for example, to initiate preheating of a reactor vessel before the first shift of the week; d) recording the calibration date of critical analog inputs so that the system ... abort the process and take whatever action is necessary to put the plant into a safe state; NOTE This example assumes that the programmable controller is able to retain the date and time of power...
Ngày tải lên: 04/04/2014, 13:46
the design and implementation of geographic information systems
... benefit the most, the applications of the technology in these functions, the data that will be needed to support these applications, the most appropriate software to support these applications ... administrative staff is now virtually eliminated Rather than entering the data themselves, now all the administrative staff needs to is validate and verify that the data are complete and accurate ... duplication of data and little congruence of the data sets, duplication of applications, variety in standards for the output of the systems, and generally a unitcentric view of GIS and what it can...
Ngày tải lên: 01/06/2014, 12:38
báo cáo hóa học:" Compressive loading at the end plate directly regulates flow and deformation of the basivertebral vein: an analytical study" docx
... underestimate the actual volume changes within the vertebral body To our knowledge, this is the first theoretical simulation to elucidate the correlation between the loading at the spinal body and the ... incidence of seeding of tumor cells Limitations exist in some aspects of the model: (1) the geometry and material properties of the vertebral body and (2) the shape of the spinal venous system [1] The ... driving force to generate the retrograde flow of basivertebral blood flow One of the advantages of this finite element method is the ability to calculate the profile of the cross-sectional area...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo khoa học nông nghiệp " A PRELIMINARY EVALUATION OF ADOPTION AND IMPLEMENTATION OF BETTER MANAGEMENT PRACTICES IN THE CATFISH FARMING INDUSTRY IN THE MEKONG DELTA, VIETNAM " ppt
... component of the present study addresses objectives two and three, and focuses on the CARD Project implementation of the BMP demonstration trials This work was conducted from the 13TH June to the 30th ... into the next phase of the BMP program, including future drafts of the BMPs themselves They also demonstrate farmers understanding and active engagement with project Limitations of the BMPs There ... connected with this trustworthy team, farmers felt at ease during the interview process and gave greater insights into their experiences The questions (Attachment 2) are based on the outcome of the...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo khoa học nông nghiệp " Achievements and lesson learnt from implementation of the project "Sustainable community-based forest development and management in some high-poverty areas in Bac Kan Province" " pot
... lands, the rights to harvest and the responsibility to protect the community forest is considered as the most important activity for the success of the implementation of CFM Community Forest Development ... from implementation of CFM plan - Capacity building for local people on the rights to access to the community forest lands, the rights to harvest and the responsibility to protect the community ... provided the seedlings to area, but it wasn 't successful The survival rate was very low due to the long distant transportation Therefore, the establishment of village nursery garden to produce the...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo khoa học nông nghiệp " The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS2 " potx
... strongly promoted by the Vietnamese government through the establishment and support for the Goat and Rabbit Research Centre at Son Tay in the north of Vietnam The initiatives developed at this ... Vietnam has been strongly promoted by the Vietnamese government through the establishment and support for the Goat and Rabbit Research Centre at Son Tay in the north of Vietnam The initiatives ... complete electronic documentation of the outputs from the activities for this period 4.1 Implementation Highlights Objective Identification and characterisation of target farms Output 1.1 Collection...
Ngày tải lên: 21/06/2014, 06:20
Project Progress Report: The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS3 " doc
... promoted by the Vietnamese government through the establishment and support for the Goat and Rabbit Research Centre at Son Tay in the north of Vietnam The initiatives developed at this centre through ... goats for Goat Pox, treatment with ivermectins to control internal and external parasites, and the development of extension materials relating to the control of disease, the construction of goat ... animals with ivermectins, and intestinal parasites are still likely to be a major problem in these goats It is imperative that all goats be treated soon, and that the project meets the costs of all...
Ngày tải lên: 21/06/2014, 06:20