... Khalif (Russia) Prof E Salazar-Lindo (Peru) Prof B.S Ramakrishna (India) Prof K Goh (Malaysia) Prof A Thomson (Canada) Prof A.G Khan (Pakistan) Drs J Krabshuis (France) Dr A LeMair (Netherlands) ... years of age experiences an average of three annual episodes of acute diarrhea Globally in this age group, acute diarrhea is the second leading cause of death (after pneumonia), and both the incidence ... five and means that more than 5000 children are dying every day as a result of diarrheal diseases Of all child deaths from diarrhea, 78% occur in the African and South-East Asian regions Each...
Ngày tải lên: 23/01/2020, 18:50
... counterparts in rural areas: 79% of parents in metropolitan areas and 76% of those in urban areas said their child used the Internet compared to 72% of parents in rural areas Finally, fathers, older parents, ... of the parents say that their child, as far as they were aware, used the Internet in a public place: Slovenia (19%) and Denmark (22%) Q5A As far as you are aware, where does your child access the ... Buying online Spending a lot of time online Using instant messaging tools Downloading/playing films Downloading/playing music Giving out personal information Accessing certain websites Using chat rooms...
Ngày tải lên: 29/03/2014, 19:20
Labor markets, gender and social stratification in east asia a global perspective
... political and economic alliances with the United States continued thereafter and remain to the present day Japan was democratized in the 1940s, and Korea and Taiwan in the 1980s In Korea and Taiwan, ... easier to perform comparisons within East Asia In a comparison of the determinants of income and class identification in Japan, Korea, and Taiwan, Arita (2009) has shown that in Korea and Japan ... differences in labor markets and the social security system Chang and England (2011) analyzed the gender wage gap in Japan, Korea, Taiwan, and China, and showed that the wage gap is greatest in Japan...
Ngày tải lên: 09/01/2020, 09:09
Tài liệu THE WEALTH REPORT 2012: A GLOBAL PERSPECTIVE ON PRIME PROPERTY AND WEALTH pptx
... German Chinese Singaporean Canadian Nationalities growing in importance Chinese Indian Brazilian Malaysian Norwegian Kazakhstani UAE Australian Indonesian Turkish Nationalities to watch Egyptian ... which dominated the global agenda for many years before the financial crisis struck Mr Buiter agrees, warning that the political backlash against income inequality, both in advanced and ... .. Bali Indonesia 5 Jakarta Indonesia 6 London UK 7 Vancouver Canada 8 Moscow Russia 9 Toronto Canada 10 Beijing China 11 Tel Aviv Israel 12 Bangkok Thailand 13 Kiev Ukraine 14 Hong Kong (apartments)...
Ngày tải lên: 16/02/2014, 11:20
facing the music shaping music education from a global perspective dec 2009
... percussion in a community music setting, preparations for teaching Balinese gamelan in theclassroom, and professional training in Indian classical music These feature thevoices and views of the musicians ... North Indian classical music I particularly remember the manyearly mornings I spent at the house of Jamaluddin Bhartiya, listening to andtaking part in his practice after first prayers and hearing ... opera in Taiwan, and sitar,gamelan, and kompang drumming in Malaysia She included allof these traditions in teaching music to seven-to-twelve-year-olds in themultinational and privileged environment...
Ngày tải lên: 11/06/2014, 01:01
Examining the factors influencing WH movement in singapore english a discourse perspective
... the formation of SCE Among the various ethnic groups, the Peranakans were the earliest English speakers and it has been argued that their vernacular, Baba or Bazaar Malay, had been influential ... of the two forms Using the ICE-SIN corpus as the primary data and Google search results as supplementary data, a comprehensive analysis is done, examining in great detail the way WH-in situ and ... buay sai jiak (Ants cannot eat.) Ants cannot be eaten (8) Mandarin (Interrogative): Ji shi kai shi? (What time start?) When is it starting? Mandarin (Declarative): Xian zai kais hi (Now start.)...
Ngày tải lên: 13/10/2015, 16:41
Facing the sanctions challenge in financial services a global sanctions compliance study
... violations of certain U.S sanctions against Iran and Sudan Financial services companies are taking note Michael Hamar, recently retired chief risk officer at National Australia Bank, says the initial ... gaining increasing attention among financial services companies Daren Allen, a UK-based partner in the international legal firm DLA Piper, who specializes in financial crime, notes that whereas ... training The optimal amount of training is open to debate, but regular education in this fast-changing area appears to be an important success factor says Mr Hamar: “The key to having capable...
Ngày tải lên: 06/12/2015, 23:05
Traditions and encounters a global perspective on the past 6th edition bentley test bank
... peoples as far away as Anatolia, Egypt, and India Topic: Forming Societies and Cultural Traditions in Southwest Asia 20. (p 37) In Mesopotamia, prisoners of war, convicted criminals, and heavily ... to guide them, the population of Mesopotamia adapted and created A social organization Topic: The Early Quest for Order Trang 24. (p 28) The word Mesopotamia means A the "pure land." ... What role did technological innovations and trade play in the rise of the Mesopotamians? What innovations led to turning points in the histories of these societies? How widely did they trade? Answers...
Ngày tải lên: 18/11/2017, 09:01
Radioactivity in the environment chapter 4 a cross cultural approach to radiation ethicsa
... ubiquitous In the Bhagavadgita, Krishna states, “I am the same to all beings…In a Brahma…and an outcast, the wise see the same thing” (The Bhagavadgita, 1973, 9:29 and 32) Similar statements are reported ... much in other parts of the world There is at least anecdotal evidence that in Latin America, in Muslim Countries, in Africa, in China, and in South East Asia, decision making is not primarily a ... say that ICRP proposed the ALARA principle (“as low as reasonably Trang 3achievable”) as early as 1958 in its Publication 1 (ICRP, 1959)b The other two principles made their first appearance in...
Ngày tải lên: 03/01/2018, 17:48
The economics of money, banking, and financial institutions (11th edition) by f s mishkin ch14 central banks a global perspective
... factors that influence how bureaucracies operate • The theory of bureaucratic behavior may be a useful guide to predicting what motivates the Fed and other central banks Explaining Central Bank ... rule out altruism Explaining Central Bank Behavior Trang 24Structure and Independence of the European Central Bank• January 1999: Start-up of the European Central Bank (ECB) and European System ... encompasses the ECB and the National Central Banks of the 28 EU member states (including the 2013 addition of Croatia as the 28th EU member state) • The Euro system comprises of the ECB and the...
Ngày tải lên: 30/06/2018, 08:45
Heavy Metals in the Environment - Chapter 10 pps
... concentration is about 0.5% of that in the plasma The citrate/transferrin ratio is 2.0 in the plasma and Ͼ720 in the cerebrospinal fluid Thus in cerebrospinal fluid Al(III) exists mainly as a citrate complex, ... from the earliest available annual average Al concentrations, taken at monthly intervals, for municipalities participating in a Drinking Water Surveillance Program conducted by the Ontario Ministry ... milligram quantities of Al consumed daily in food and drinking water In a study of epidemiological aspects of Alzheimer’s disease in 1984, Heyman et al reported that the intake of Al-containing antacids...
Ngày tải lên: 11/08/2014, 15:20
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... cross-linking assay, the samples were incubated at room temperature, as described above for the EMSA assay, and then irradiated at 302 nm for 10 using a transilluminator (Bio-Rad Laboratories) The ... accompanied by a dramatic increase in protein methylation at as many as nine lysine residues, without any change in the protein or mRNA levels [43] This modification, as well as other post-translational ... molecular nature in normal and cancer cells, we performed a comparative bidimensional PAGE analysis of nuclear extracts coupled to Western blotting analysis with an eEF 1A mAb As an internal normalizer...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Bridging the gap between in silico and cell-based analysis of the nuclear factor-jB signaling pathway by in vitro studies of IKK2 ppt
... a random sequential model, values for Km,ATP, Km,GST-IjBa, Vmax and a was determined from the global t The constant a is the ratio of apparent dissociation constants for binding GST-IjBa in the ... performed using the same protocol as that described for the kinase time-course assay The assay was again repeated with the inclusion of 10 mm MnCl2 in the kinase condition In vitro analysis of ... function in gepasi The mathematical model described here has been submitted to the online Cellular Systems Modeling Database and can be accessed at http://jjj.biochem.sun.ac.za/database/ihekwaba/ index.html...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC ... GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT...
Ngày tải lên: 29/03/2014, 21:20
Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice 2
... predicted amino acid sequence revealed an amino-terminal SH2 domain, a central 5’phosphatase domain, two NPXY sequences and a proline rich C-terminal tail This protein was named SH2-containing inositol ... Behring and Shibasabo Kitasato in Koch’s laboratory discovered that injecting diphtheria toxin into animals produces a serum containing an antitoxin that provided passive antidiphtheria immunity ... BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen BD Pharmingen Santa Cruz BD Pharmingen BD Pharmingen Santa Cruz Sigma Santa Cruz...
Ngày tải lên: 14/09/2015, 09:08
Elucidating the role of dok 3 in b cell receptor signaling using gene knockout mice
... signaling Both adaptors act as negative regulators of Ras and mitogen activated protein kinase vi (MAPK), in particularly Extracellular signal-regulated kinases (Erk) Dok-1 and may exert their inhibitory ... Keong, Kar Wai, Andy, Valerie, Ann Teck, Jianxin and Koon Guan for sharing reagents and meaningful discussion about science and the companionship for the past years Weng Keong, thanks for managing ... protein kinase kinase Mitogen activated protein kinase kinase kinase Major histocompatibility complex Macrophage colony-stimulating factor Muscle-specific receptor kinase Nuclear factor κB Pathogen-associated...
Ngày tải lên: 14/09/2015, 10:44
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
... zymogenicity of free FVIIa are as interesting as those involved in the TF-induced allostery Amino acid residues in FVIIa that are involved in the conformational balance that governs the equilibrium between ... Biaevaluation 4.1 supplied by the manufacturer (Biacore AB) N-terminal pegylation and carbamylation In the pegylation experiments, G37 2A- FVIIa and FVIIa at a concentration of 10 lm, alone or after ... Inc., San Diego, CA, USA) The model of G37 2A- FVIIa was created by mutating the side chain in FVIIa taken from the FVIIaặTF structure [9] (Protein Data Bank accession number 1dan) using the mutation...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf
... 420, 422 and 428 aa; nine aa in total) were located near the interface of the physiological dimer The Cterminal domain may contain structural features involved in protein–protein interactions ... are shown as cylinders The ‘lid’ (26-29 aa) is shown in magenta Fig C-terminal domains in the F, N, G, T and TG structures The backbone atoms of the C-terminal domain (1-305 aa) in the F (black), ... l-glutamate in an extended form ˚ (Fig 7A) with a contact area of 288 A2 Asparaginase binds l-glutamate in a folded form (Fig 7B) in an apparently much smaller pocket with a contact area of ˚ 233 A2 These...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Identification of tyrosine-phosphorylation sites in the nuclear membrane protein emerin pot
... throughout the preparation SILAC: sample preparation Human cervical carcinoma (HeLa) cells were grown in Dulbecco’s modified Eagle’s medium containing ‘light’ arginine and lysine or 13C6-arginine and ... emerin Remarkably, this site is at the primary structure level far away from the N-terminal LEM-domain that is thought to mediate this interaction [40] Lamin -A binding has been mapped to the ... carboxy-terminal amino-acid residues, respectively) The SILAC approach (Fig 3A) is based on in vivo labeling of all the cellular proteins by isotope-coded amino acids In addition, we used the determination...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Regulation of arginase II by interferon regulatory factor 3 and the involvement of polyamines in the antiviral response potx
... 5¢-ACAATGAGCTGCTGGTGGCT-3¢ and 5¢-GATGGGCACAGTGTGGGTGA-3¢; murine b-actin, 5¢-TGGAATCCTGTGGCATCCATGAAAC-3¢ and 5¢-TA AAACGCAGCTCAGTAACCGTCCG-3¢ Human GAPDH primers were included in the Advantage ... peptone-activated and IFNc-activated macrophages exhibited increased arginase activity and were resistant to HSV infection by a mechanism that was prevented by the addition of arginine, suggesting an ... manner ArgII is a mitochondrial enzyme involved in the polyamine synthesis pathway through the catalysis of l-ornithine production from l-arginine Of the natural polyamines, spermine and to a...
Ngày tải lên: 07/03/2014, 21:20