array of char pointer in c

Ip 08 array of array and struct in c

Ip 08 array of array and struct in c

... kiểu c? ??u tr? ?c tr? ?c: :  struct > { ; ; f };  Khai báo biến c? ??u tr? ?c tr? ?c: : > ; >; Nhập mơn lập trình - GV.Nguyễn Minh Huy struct HocSinh { char hoten hoten[50]; [50]; char ngaysinh[11]; ngaysinh[11]; ... ngữ Viết chương trình trình::   Nhập vào h? ?c sinh sinh Xuất thông tin h? ?c sinh vừa nhập nhập Nhập mơn lập trình - GV.Nguyễn Minh Huy 12 Kiểu c? ??u tr? ?c  Kiểu c? ??u tr? ?c C: Kiểu liệu ph? ?c hợp hợp ... nhiều chiều chiều Kiểu c? ??u tr? ?c tr? ?c Nhập mơn lập trình - GV.Nguyễn Minh Huy 11 Kiểu c? ??u tr? ?c  Xét chương trình sau: sau:  Thông tin h? ?c sinh gồm gồm::      Họ tên tên Ngày sinh sinh Giới

Ngày tải lên: 11/04/2023, 18:48

21 2 0
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

... Pediatric Research Unit, CRCHUL ⁄ CHUQ, Faculty of Medicine, Laval University, Quebec, Canada ´ Quebec Proteomic Center, CRCHUL ⁄ CHUQ, Faculty of Medicine, Laval University, Quebec, Canada ´ Cancer ... of enzyme which hydrolyses lmol substratmin)1) It remains possible that more chronic alteration of circulating insulin results in significant changes of circulating DPP IV Indeed, further fractionation ... apical membrane by endocytosis [16] In Madin–Darby canine kidney (MDCK) cells, a study of chimeric forms of DPP IV has shown that the luminal domain of DPP IV carries dominant apical sorting information

Ngày tải lên: 19/02/2014, 07:20

12 738 0
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt

... Idi1 forward, CCTAGCTTGGCTGACAGAGG; reverse, CTGCTCCTTCTCCTTCATGC forward, TACAACCACAAGGCGCTACA; reverse, AAGGGCCTGACTCCATAGGT forward, CAGGAAGAACCGTTGGAGTT; reverse, TTGCTCTCGTTCCAAAAGGA forward, ... AAGGAAGGCTGGAAAAGAGC reverse, TACAGCTTCACCACCACAGC forward, TTTGATGCAGGTGTTTGAGG reverse, CCACCTGTAGGTCTGGCA forward, CCTTGCCCTACAGCTGAGTC reverse, CTTGTCTTCTGTGCCTGTGC forward, GTTTGAATTGGCCAGAGGAA ... AGGTGCAGCAGCTTCAGTTT forward, CAGTGCTGGAATTGTACGTGA reverse, AGTCCATGAGTTGGCCCATA forward, CCTATGAGCACCTGACCACA reverse, AGGCCACTGACTAGGCTGAA forward, GAGCAGGTCCAGGAACATTG reverse, GGGATAACTCGTCTCCACCA

Ngày tải lên: 07/03/2014, 03:20

12 562 0
Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

... 5¢-ATC CGG GGT CTC CCATG GCA ATG AGG GCC TGG GGT G-3¢; HCV-1a Core+1/S antisense, 5¢-AT CCG GGT CTC GGTACC TTA TCA CGC CGT C TT CCA GAA C- 3¢; and HCV-1b Core+1/S antisense, 5¢-AT CCG GGT CTC GGTACC ... liver cirrhosis within 20 years of infection, with the possible development of hepatocellular carcinoma (HCC) in 1–4% of cases [3] No prophylactic vaccine against HCV exists, and the efficiency of ... using a template plasmid ´ pRSV/BNT (kindly provided by C Brechot) [69] and the following primers: sense, 5¢-CAT GCC ATG GCA CCA ACC GCC GCC CAC A-3¢; and antisense, 5¢-CCC AAG CTT GGG GGG CGC

Ngày tải lên: 15/03/2014, 09:20

16 499 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

... Department of Cell Biology and Diabetes Research Centre, University of Linkoping, Sweden ă Department of Molecular and Clinical Medicine, University of Linkoping, Sweden ă Department of Medicine and Care ... referring to all of them as caveolae, was demonstrated by their content of both caveolin-1 and caveolin-2 The coexistence of caveolin-1 and caveolin-2 in all three caveolae subclasses is in line ... densitometric units and normalized to percentage of maximum (A) Protein concentration (mgỈmL)1) (B) Caveolin-1 (C) Caveolin-2 (D) Cell surface biotin labelling of proteins (E) TGN38 (F) Insulin receptor

Ngày tải lên: 16/03/2014, 13:20

12 460 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

... 2201, E-mail: cigr@nmr.mpibpc.mpg.de Abbreviations: SP -C, surfactant-associated protein C; hSP -C, human SP -C; pSP -C, porcine SP -C; rSP -C, recombinant human SP -C; rSP -C (FFI), FFI variant of recombinant ... NN (i,i+1) connectivities clearly show the a-helical structure of rSP -C (FFI). In addition, 3 J NHa coupling constants are summarized, with small circles indicating couplings < 5.0 Hz and large circles ... concentra- tions can be obtained in dodecylphosphocholine micelles in which SP -C is stable for months in its a-helical form [8]. The surfactant consists of  1% by weight of SP -C [31]. The concentration of

Ngày tải lên: 16/03/2014, 16:20

10 426 0
Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

... CGGTGGCGACGACTCCTGGAGCCC-3¢; PR, 5¢-CG GGATCCCAACTGGTAATGGTAGCGACCGGC-3¢; P2-1, 5¢-ATGGAYATHGCIACIACICARGC-3¢; P2-2, 5¢-TAGCAACTCATTCGTCACTGTC-3¢; P2-3, 5¢-GGA ATTCTAGATATCGTCGACAATTTGTGTTACTACC ... 5¢-CAGATAGGAAGAGGG GCAAGGA-3¢; P4-3, 5¢-GGAATTCTAGATATCGTC GACTTATCTTCAGAACTTGTTGC-3¢; P4-4, 5¢-GGA ATTCGTCGACGCGTTTTTCAACAAATCATCATAT A-3¢; TAG1, 5¢-GGAATTCTAGATATCGTCG-3¢; TAG2, 5¢-GGAATTCGTCGACGCG-3¢ Computer ... (1999) Conservation of structure and cold-regulation of RNA-binding proteins in cyanobacteria: probable convergent evolution with eukaryotic glycine-rich RNA-binding proteins Nucleic Acids Res

Ngày tải lên: 17/03/2014, 09:20

16 530 0
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx

Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx

... pro- pose that this activity facilitates efficient folding of pro- teins containing cis prolines in psychrotrophic bacteria at low temperatures. According to the crystal structures of L. pneumophila MIP ... not contain it. Overproduction and purification Upon induction for overproduction at 10 ? ?C, N-domain + and C- domain + accumulated in the cells in a soluble form, whereas C- domain – accumulated in the ... suggesting that C- domain + assumes a similar structure to that of the C- domain in the intact molecule. In contrast, the spectrum of C- domain – was quite different from those of C- domain + and

Ngày tải lên: 23/03/2014, 13:20

11 333 0
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

... biotin (data not shown). Effect of point mutations in the binding domain of a-2 -C on the binding to c? ?-2 To elucidate whether single amino acids in the binding domain of a-2 -C were particularly ... of the C- terminal, cytosolic domain of c- 2 (c? ?-2, C- terminal 59 amino acids) with a-2 or C- terminal deletion mutants of a-2. PCR prod- ucts comprising the appropriate DNA fragments were obtained ... coli. The construct of a-2 -C covers the 151 C- terminal residues of a-2 and has an N-terminal extension of the four residues MTVD. The construct contains the C- terminal biotin-binding domain and

Ngày tải lên: 23/03/2014, 13:20

10 334 0
Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc

Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc

... a catalytic subunit can activate a kinase By contrast, binding an activating regulatory coprotein to an inactive catalytic subunit can activate a kinase In many signal-transducing protein kinases, ... threonine residues followed by a stretch of acidic amino acids [19,21], which constitutes a consensus Fig Phospho-speci? ?c antibody against an Hsp90 cochaperone, Cdc37 (A, B) Recombinant Cdc37 was incubated ... and 8) completely abolished antibody binding (Fig 1A), indicating that anti-[pSer13]-Cdc37 specifically recognized the CK2-phosphorylated form of Cdc37 The presence of equal amounts of Cdc37 in the

Ngày tải lên: 30/03/2014, 03:20

14 349 0
Báo cáo khoa học: Regulation of the muscle-specific AMP-activated protein kinase a2b2c3 complexes by AMP and implications of the mutations in the c3-subunit for the AMP dependence of the enzyme docx

Báo cáo khoa học: Regulation of the muscle-specific AMP-activated protein kinase a2b2c3 complexes by AMP and implications of the mutations in the c3-subunit for the AMP dependence of the enzyme docx

... AMPK a1b 1c1 inE. coli using a tricistronic vector with T7 RNA polymerase controlling transcription of a single a1b 1c1 messenger, with each subunit carrying its indi- vidual ribosome-binding site. In ... used [44,47]. In line with these studies, we did not detect any increase in phos- phorylation of a2ina2b 2c3 complexes by LKB1 or CAMKKb in the presence of increasing concentrations of AMP (Fig. ... adenosine derivatives form a binding contract. J Clin Invest 113, 182–184. 22 Woods A, Cheung PC, Smith FC, Davison MD, Scott J, Beri RK & Carling D (1996) Characterization of AMP-activated protein kinase beta

Ngày tải lên: 30/03/2014, 08:20

10 557 0
color atlas of oral diseases in children and adolescents  -  c. scully, r. welbury (mosby, 1994)

color atlas of oral diseases in children and adolescents - c. scully, r. welbury (mosby, 1994)

... 18,50-51 Coxsackie virus infection 94 Craniosynostosis l, 25 Crohn's disease 89 C r o u z o n ' ss y n d r o m e1 , , Cusp of Carabelli 47, l5l Cyanosis, central 83 C y c l o s p o r i n Cystic fibrosis ... immunodeficiency, congenital15,32, 42 leukaemia99 mucosal81.271 Candidosis-endocrinopathysyndrome15, 32,43 Carcinoma, oral I 19, 392 Cat scrâtch disease 119, 393 Cellulitis 120,394 Cerebral palsy ... & Scully C Paediatricoral medicine.4 The gingiva (1988).Dental Update,15: 198-201 LukerJ & ScullyC Paediatric oral medicine The oral mucosa(i) (1988).Dental Update,15:292-298 LukerJ & ScullyC

Ngày tải lên: 12/05/2014, 17:36

127 375 0
Báo cáo sinh học: " Role of HIV-1 subtype C envelope V3 to V5 regions in viral entry, coreceptor utilization and replication efficiency in primary T-lymphocytes and monocyte-derived macrophages" docx

Báo cáo sinh học: " Role of HIV-1 subtype C envelope V3 to V5 regions in viral entry, coreceptor utilization and replication efficiency in primary T-lymphocytes and monocyte-derived macrophages" docx

... utilization of sub- type C HIV-1 could be predominantly R5 even late in infection. Syncytium inducing capacity of subtype C chimeras We examined the syncytium-inducing ability of the sub- type C env chimeras ... designation in Fig. 1 and Table 1) using U373-MAGI indicator cell lines. These cell lines express the CD4 receptor in conjunction with either CCR5 or CXCR4 as a coreceptor and can be infected with ... lymphocyte cell lines but replicated in PBL and MDM. In addition, these chimeras were able to infect U373MAGI-CD4 + -CCR5 + but not U373MAGI-CD4 + -CXCR4 + cell line, suggesting CCR5 coreceptor utilization

Ngày tải lên: 18/06/2014, 18:20

12 410 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

... screening cell lines in cellular proliferation assays and from cell cycle analyses. Cell lines were classified into one of three categories based on the time when the majority of cells contained ... proliferating nature of the established cell lines in tissue culture. Since cancer cell death is a more desired response in clinic, measures of cell death were used as the criteri a to categorize ... Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer. Clin Lung Cancer 2006, 8:93-98. 37. Mazzino A, Muratore-Ginanneschi P, Musacchio S: Scaling properties of the two-dimensional

Ngày tải lên: 18/06/2014, 22:20

10 619 0
Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc

Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc

... 4 h.p.i in cells infected with the recombinant VT7-HCV7.9 virus in the presence of IPTG, in contrast with cells infected in the absence of the inductor, or in cells inducibly expressing the VP3 ... Cellular localization of HCV proteins by immunofluores-cence microscopyFigure 2 Cellular localization of HCV proteins by immunofluo- rescence microscopy. Subconfluent HeLa cells were infected at ... reduced in VT7-HCV7.9 infected cells when compared to protein synthesis in the absence of the induc- tor. This translational inhibitory effect was specific, since protein synthesis was not affected

Ngày tải lên: 19/06/2014, 08:20

19 375 0
báo cáo hóa học: " Responsiveness of EORTC QLQ-C30, QLQ-CR38 and FACT-C quality of life questionnaires in patients with colorectal cancer" pptx

báo cáo hóa học: " Responsiveness of EORTC QLQ-C30, QLQ-CR38 and FACT-C quality of life questionnaires in patients with colorectal cancer" pptx

... responsive in patients receiving chemotherapy. Keywords: Colorectal cancer, Quality of life, EORTC QLQ -C3 0, EORTC QLQ-CR38, FACT -C, Responsiveness Introduction Colorectal cancer (CRC) is common in Western ... Abbreviations CRC: ColoRectal Cancer; EORTC: European Organization for Research and Treatment of Cancer; ES: Effect Size; FACT -C: Functional Assessment of Cancer Therapy-Colorectal; FACT-G: Functional ... t of functional or symptom scales and s ingle items. The spe- cific consequences of rectal radiotherapy are more accu- rately detected by adapted disease-speci fic subscales. The CCR Specific,

Ngày tải lên: 20/06/2014, 15:20

10 717 1
Báo cáo khoa học: "An experimental system for the quantitative C-labelling 14 of whole trees in situ" pps

Báo cáo khoa học: "An experimental system for the quantitative C-labelling 14 of whole trees in situ" pps

... in the chamber occurs. In such conditions, an increase in temperature of 15-20? ?C during the course of feeding (cf fig 2), could lead to a leakage of 6% of the air in ... photosynthetic rates, maintaining the CO 2 concentration at nor- mal values is necessary. Achieving accu- rate regulation of CO 2 requires continuous measurement of its concentration ... initial radioactivity injected, n the total amount of CO 2 injected from cold carbonate since the beginning, and N the amount of CO 2 constantly present in the chamber. From

Ngày tải lên: 08/08/2014, 23:22

10 269 0
w