... diluted to the extent that its zone of inhibition came in linear range (preferably in the range of the zone of inhibition of the reference concentration) In this experiment, the reference concentration ... after selecting the model to obtain better estimates of kinetic parameters The dosage regimen of ceftriaxone was also determined based on the kinetic data The priming (D) and maintenance (D ) ... function the levels of various enzymes, responsible for the metabolism of these antimicrobials, is altered, changing the elimination and biotransformation pattern of drug during fever [18] The...
Ngày tải lên: 07/08/2014, 18:21
... nietorp detcepxe na sisylana tolb nretseW eht no desaB nietorp desserpxe latot eht fo %8.3 tuoba detutitsnoc nietorp 2PV eht taht detamitse saw tI sunimret-C eht ta qat eniditsihylop htiw rehtegot ... detcejni erew taht snekcihc neves fo tuo xiS tnemirepxe eht tuohguorht sretit ydobitna elbatceted tnacifingis on dah sdrib lortnoc detcefninu ehT VDBI htiw detcefni ton erew sdrib eht taht gnitacidni ... lasrub tsniaga noitcetorp ecudni ot laitnesse si ,suriv evil ni tneserp era taht sepotipe lanoitamrofnoc etairporppa eht tsniaga ,sretit ydobitna hgih fo ecneserp eht taht detartsnomed yduts siht...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Production and purification of immunologically active core protein p24 from HIV-1 fused to ricin toxin B subunit in E. coli" ppt
... and XbaI sites After cloning the PCR products in the Topo 2.1 vector, p24 was cloned downstream of RTB by ligating the XhoI site on the 3' extreme of RTB to the SalI site at the 5' of the p24 sequence ... sites In this work, we fused p24 to the C-terminal domain of RTB and our results demonstrate that apparently the position of the foreign protein does not affect the carrier-adjuvant abilities of ... retained lectin activity and therefore, it is likely that after i.n administration, binding to M cells by RTB increased the uptake and transport of p24 to the nasal lymphoid tissue On the other...
Ngày tải lên: 12/08/2014, 04:21
Tài liệu Khảo sát sự ô nhiễm Coliforms, E.coli, S.aureus trong kem, sữa tươi, bánh ngọt tại cửa hàng bán lẻ trên quận 4 của Hà Nội docx
... Qua cốc TT Qua cốc TT Qua cốc TT Qua cốc TT Qua cốc TT
Ngày tải lên: 19/02/2014, 10:20
Báo cáo khoa học: Translation initiation region dependency of translation initiation in Escherichia coli by IF1 and kasugamycin pdf
... whereas the 3A¢ ⁄ total protein ratio is increased about two-fold Taken together, the data suggest that most of the increase in the 3A¢ ⁄ 2A¢ ratio in the mutants is the result of changed functionality ... products are connected to the TIR-specific response of the IF1 mutants, suggesting that the imbalance in the mRNA translation is the primary reason for the cold sensitivity of the infA mutants studied ... dependence of translation initiation by IF1 located the antibiotic to the ribosomal tunnel region As the effects of the R40D and the R69L mutations are dependent on the sequence upstream of the initiation...
Ngày tải lên: 29/03/2014, 09:20
a course in universal algebra - s. burris and h.p. sankappanavar
... manuscript through NSERC Grant No A7256 Also thanks go to the Pure Mathematics Department of the University of Waterloo for their kind hospitality during the several visits of the second author, and to ... Our notation in this chapter is less formal than that used in subsequent chapters We would like the reader to have a casual introduction to the subject of lattice theory The origin of the lattice ... letting Au be the set of upper bounds of A in P, it is routine to verify that Au is indeed A The other half of the theorem is proved similarly In the above theorem the existence of ∅ guarantees...
Ngày tải lên: 31/03/2014, 14:57
Production and Cost in the U.S. Paper and Paperboard Industry pdf
... evidence that output can be increased at constant input ratios Also, given the reported test results for homotheticity and output homogeneity, it is not surprising that the estimation results also ... either not 14 V.3 Tests on Properties of the Production Function Table reports results for testing more restrictive forms of the cost function and underlying production technology To test for ... the industry’s variable cost of producing output Qt at time t, Pit (i = 1, … , i) is the price of the ith input at time T, and Kt is the quasi-fixed level of capital at time t T is a time index...
Ngày tải lên: 01/04/2014, 00:20
Báo cáo lâm nghiệp: "Composition of psocid taxocenoses (Insecta: Psocoptera) in Fageti-Piceeta s. lat. and Piceeta s. lat. forests in the Western Carpathian Mts" pps
... single habitats of the 7th AVZ occur in the field of the 4th and 5th AVZ From the view of hydricity (q-axis), habitats of the 7th AVZ are on the same level as those of the 4th–6th AVZ Diversity indexes ... hydricity of habitat does not correlate with altitude within collected material Habitats of the 7th AVZ are situated “higher” than habitats of the 8th AVZ in the graph of x-q axis (Fig 1) and thus ... DCA-analysis, habitats of the 7th AVZ create a field, which is located on the left side of the whole dotted field (along x-axis) It forms the highest AVZ together with fields of the 8th and 9th AVZ Only...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx
... GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA CCGGAATTCTTATTTCCCTTCTCTCATCTC GCGCGCCATGGAAAAAGATCTACAGTTAAGA GGGGGATCCCCATAATCCACTCCACCTGCTAAA GGGGGGGATCCT CATTATTTCCCTTCT AATACCGCCATGTATAATATCTATTACTTC GTAATAGATATTATACATGGCGGTATTGAA ... used to subtract out the contribution of unbound PLP from the spectra of proteins Results The expression of poraSE was first carried out at 37 °C with a shaking speed of 180 r.p.m It is worth noting ... 5¢-phosphate via an azomethine link between the formyl group of the cofactor and the amino group of a protein residue In contrast, the absence of absorption maximum at 420 nm of the mutant enzyme spectrum...
Ngày tải lên: 30/03/2014, 15:20
báo cáo khoa học: "Engineering of the E. coli Outer Membrane Protein FhuA to overcome the Hydrophobic Mismatch in Thick Polymeric Membranes" pdf
... Δ1-159 Ext channel, or b) local perturbation of the polymersome membrane near to the protein rendering it slightly permeable to TMB At the actual state of the art we cannot distinguish between the ... of choosing the polymer to match the protein, we match the protein to the polymer A simple “copy-paste” strategy to double the last amino acids of each of the 22 b-sheets prior to the more regular ... using the Soret absorption band, the total amount of encapsulated enzyme could not be detected The kinetic data obtained in presence of the FhuA Δ1-159 Ext, were compared to a set of negative controls...
Ngày tải lên: 11/08/2014, 00:23
Canonical structures in potential theory - s s vinogradov, p d smith, e d vinogradova
... associated with the Abel integral transform method is straightforwardly justified, so there is no doubt about the validity of solutions obtained by this approach The name of the method highlights the ... involving the coefficients an The coefficients an are then obtained from the calculation of the Fourier coefficients of the piecewise continuous function obtained by the transform of the right-hand side of ... electrostatics and elasticity From a mathematical point of view, the study of Laplace’s equation has profoundly influenced the theory of partial differential equations and the development of functional...
Ngày tải lên: 17/03/2014, 14:41
Báo cáo khoa học: " Low numbers of intestinal Shiga toxin-producing E. coli correlate with a poor prognosis in sheep infected with bovine leukemia virus" pps
... 0∼4 for neoplasia by a veterinary pathologist unfamiliar with the treatment assignments Statistical analysis Health status, pathology, and total B lymphocytes were analyzed independent of STEC treatment, ... putting the sheep from groups and at a long-term disadvantage and making them more vulnerable to BLV, especially after cessation of STEC treatment at months and removal of protective effects of ... stimulate these cells to proliferate [6] Thus, two opposing STEC-related factors, i.e stimulation of B-cell expansion and elimination of BLV-positive B cells could confound the analysis of the...
Ngày tải lên: 07/08/2014, 23:22
Báo cáo khoa hoc:" Failure of E. coli bacteria to induce preterm delivery in the rat" ppsx
... development of the rat model, analysis of data, and drafting of the manuscript YF contributed to the development of the rat model, carried out the experiments, analyzed results and helped draft the ... humans that will diminish the burden of premature birth Competing interests The authors declare that they have no competing interests Authors' contributions EH contributed to the conception and ... able consistently to catheterize one uterine horn to the desired distance of cm and infuse it with the dye solution with retention of dye in the uterine horn, continued viability of fetuses (verified...
Ngày tải lên: 11/08/2014, 07:21
Báo cáo khoa học: " Acute phase response in two consecutive experimentally induced E. coli intramammary infections in dairy cows" pptx
... of the study, carried out the experiments, interpretated the results, drafted the manuscript and carried out coordination among authors, TO carried out laboratory analyses of acute phase proteins, ... period of days: during the first day every hours and thereafter twice a day at the time of milking Heart rate, rectal temperature, rumen motility, appetite and general attitude were evaluated The ... statistical analysis and interpretation of the results and drafted the manuscript, HJ and JS carried out the experiments and participated in drafting the manuscript, SP made substantial contribution...
Ngày tải lên: 12/08/2014, 18:22
Báo cáo khoa học: "Transfer of immunoglobulins through the mammary endothelium and epithelium and in the local lymph node of cows during the initial response after intramammary challenge with E. coli endotoxin" ppt
... comments The results from this study show that, in general, the transfer of Ig through the endothelium is merely a result of diffusion while the transfer through the epithelium and the concentrations ... being the largest molecule of the Igs, showed the lowest relative transfer through the endothelium which supports the speculation that the molecular size influences the transfer During the inflammatory ... gland tissue but rarely close to the epithelial cells [25] The highest CR of IgM at the mammary epithelium was, surprisingly, recorded at h In contrast to the endothelial CR, the epithelial CR of...
Ngày tải lên: 12/08/2014, 18:22
Báo cáo y học: "Dramatic increase of third-generation cephalosporin-resistant E. coli in German intensive care units: secular trends in antibiotic drug use and bacterial resistance, 2001 to 2008" pot
... dividing the number of resistant isolates by the total number of the isolates of the same species tested against the corresponding antibiotic multiplied by 100 The incidence density of resistant isolates ... Industrial standard or CLSI Copy strains - Page of defined as an isolate of the same species showing the same susceptibility pattern throughout a period of month in the same patient, no matter what the ... Limiting administration of these antibiotics to patients in which other therapeutic alternatives according to evidence-based guidelines are not possible is therefore part of many antibiotic stewardship...
Ngày tải lên: 13/08/2014, 20:22
Báo cáo y học: "DNA signatures for detecting genetic engineering in bacteria" ppt
... 100 The computational cost to build the hash table is the number of k-mers (proportional to the total number of bases given as input) times the cost of inserting a pointer to the originating ... between the artificial vector sequence where the first signature appears at k = 23 and the natural plasmids with the two highest numbers of shared nucleotides (Note that, for clarity, matches to other ... artificial sequence and the two respective plasmids The number next to each line is the length of exact match (for matches of 100 or more bases) Functional annotation for the artificial vector...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo sinh học: "Comparative expression profiling of E. coli and S. aureus inoculated primary mammary gland cells sampled from cows with different genetic predispositions for somatic cell score" ppt
... Physiology at the Vetsuisse Faculty of the University of Bern for their hospitality and assistance The financial support of the German Federal Ministry of Education and Research (BMBF) (Projekt FUGATO ... genotype, treatment and time point as factors was analyzed A variety of tests was performed to confirm the effects of the QTL allele on cell culture and inoculation and to survey the consistency ... coordinated the study and participated in the interpretation of the data and critically revised the manuscript SP, AH and DR participated in the microarray analyses and AH performed the miroarray...
Ngày tải lên: 14/08/2014, 13:21