... text and its social situation British discourse analysis was mainly influenced by M.A.K Halliday‘s functional approach to language Halliday‘s framework emphasized the social Trang 13As can be ... comprehension and the discussions of discourse analysis and the teaching of reading comprehension are presented The application of discourse-based approach in teaching reading is the application of the ... Ha Noi - 2013 Trang 3iv TABLE OF CONTENTS Page Declaration i Acknowledgements ii Abstract iii Table of contents iv Abbreviations vi List of graphs, charts and tables vii PART A:
Ngày tải lên: 28/03/2015, 09:26
... production of large amounts of maltose and maltotriose, and relatively... non-reducing end of a chain [21] In humans, sucrase-isomaltase is far more abundant than maltase-glucoamylase, and ... inhibition of αglucosidase and α-amylase can significantly reduce the post-prandial increase in blood glucose after a meal, with starch as the major calorie intake The apparent advantage of ... glucoamylase, dextrinase, maltase, and sucrase, as well as pancreatic αamylase in vitro and in vivo [34] Due to the presence of intramolecular nitrogen (Figure 4), acarbose... than human salivary
Ngày tải lên: 10/09/2015, 09:01
Adaptation and application of a state of the art impedance analyzer for characterization of silicon p i n diodes
... ADAPTATION AND APPLICATION OF A STATE-OFTHE-ART IMPEDANCE ANALYZER FOR CHARACTERIZATION OF SILICON P-I-N DIODES PANJI G. I. SURYACANDRA NATIONAL UNIVERSITY OF SINGAPORE 2011 ADAPTATION AND ... resistor and µF standard capacitor at measurement frequency of 0.1 Hz. As a consequence of this small phase angle standard deviation, the capacitance of standard semiconductor samples can be determined ... inaccuracy of the extracted resistances and capacitances from the computer based fittings are smaller than the least decimal displayed on Table 4.5. The inaccuracy of the calculated time constant can
Ngày tải lên: 26/09/2015, 10:59
Development and application of a web based kanban system
... of material in the container accompanying the kanban and kanban number. Figure 2.3 shows a schematic representation of a general kanban. MATERIAL NAME PART NUMBER QTY OF MATERIAL KANBAN NUMBER TYPE ... the material, quantity of material in the container accompanying the kanban and kanban number Figure 2.3 shows a schematic representation of a general kanban MATERIAL NAME PART ... Staging Area (PSA) X KEY: Box with raw material Box with processed material M aterial Staging Area (MSA) Y P Production Kanban W W ithdrawal Kanban Box without material M Material transfer W
Ngày tải lên: 04/10/2015, 15:45
Application of a human bone engineering platform to an in vitro and in vivo breast cancer metastasis model
... combination of anti-hormonal therapies with the application of chemotherapeutic drugs as well as radiation therapy and the introduction of the monoclonal antibody Trastuzumab (Herceptin®) dramatically ... Mineralisation - Alizarin red S 167 5.2.2.3 Mineralisation - Wako HRII calcium assay 167 5.2.3 In vitro characterisation of hOBs and hMSCs on a medical grade polycaprolactone tricalcium phosphate ... primary tumour These are important diagnostic tools, as early diagnosis and treatment of this disease is crucial and vastly affecting the 5-year survival rate First line therapy of breast cancer
Ngày tải lên: 07/08/2017, 15:52
The application of a profluorescent nitroxide probe to detect reactive oxygen species derived from combustion generated particulate matter
... mass and are composed mainly of organic species, whereas accumulation mode particles comprise the majority of submicron PM mass and are primarily made of soot This demonstrates that the mass of ... the uptake of fumigation technology using ethanol as a supplementary fuel BPEAnit was also applied to assess the potential of particles produced by an automatic pellet boiler and a traditional logwood ... the BPEAnit assay, the overall increase of fluorescence is measured and based on that, the amount of probe that reacted can be calculated A potential source of error when measuring only overall
Ngày tải lên: 07/08/2017, 15:52
THE APPLICATION OF A TANDEM DIKE SYSTEM IN VIETNAM
... wave attacks In addition, application of this approach may be suitable for a relatively low land value at a narrow strip along the shore but a high value hinterland Moreover, use of this approach ... (defense zone) Aspects of social, economic, environmental and technical characters are taken into account to perform analysis criteria Finally application is made for the case studies of coastal flood ... as the amount of damage of the transition area when this area is inundated are aspects that cannot be neglected Re-used materials: At some place the existing dikes are there and can be used as
Ngày tải lên: 27/03/2019, 14:49
The technical development and application of a recirculating aquaculture respirometer system (RARS) for fish metabolism studies
... period) Day and night data was used from the 5th day of UO and MO period from every temperature phase 89 Trang 7LIST OF FIGURES Fig 1: Central cascade of catabolic metabolism of ammonotelic animals; ... Kunststoff-Spranger GmbH (Plauen, Germany) Each PVC tank has a volume of 250 l, with part of the tank made of translucent PVC The sides and the back are made of opaque PVC in order to avoid visual ... msemi-ade sequential measurements of each tank to eliminate the problem of sensor variation associated with multi-probe setups The accuracy of the analyzers in relation to measurement range was:
Ngày tải lên: 27/09/2019, 10:31
Application of a probit model in assessing determinants of formal financial saving behavior of rural households: The case of Sinana district, Ethiopia
... They are also character-ized as seasonal and irregular as the cash flow through the sale of agricultural products and availability of work is also seasonal (Dejene, 2003) Saving is a very important ... hectares with a stan-dard deviation of 1.14 Rural households who have a larger area of farm land can utilize more capital and finally their income increases so that their probability to save in a ... questionnaire was trans-lated to the local language (Afaan Oromo) and collected in July, 2017 under the supervision of the author The statistical software packages used for the data analysis are SPSS
Ngày tải lên: 16/01/2020, 13:39
Application of a strategy based on metabolomics guided promoting blood circulation bioactivity compounds screening of vinegar
... exchange resins was evaluated by univariate method An overall evaluation of data showed that the larger loading capacity, and less Fig 2 Multivariate statistical analysis of RV and WV a PCA score ... table was used as input data for multivariate statistic analysis Multivariate statistical analyses, including unsupervised principal component analysis (PCA) and orthogonal par-tial least-squares-discriminant ... to accelerate the synthesis of abundant aromatic and functional materials, such as esters and TMPZ [1] Changes of aromatic and functional materials in aging process were learned in recent years
Ngày tải lên: 29/05/2020, 13:59
Predictors of cervical cancer screening practice among HIV positive women attending adult anti-retroviral treatment clinics in Bishoftu town, Ethiopia: The application of a health belief
... anti-retroviral treatment clinics in Bishoftu town, Ethiopia: the application of a health belief model Kalkidan Solomon*, Mulugeta Tamire and Mirgissa Kaba Abstract Background: Cervical cancer is a global ... commonly diagnosed cancer after breast cancer and the third leading cause of cancer death after breast and lung cancers [3] In Sub-Saharan Africa, it is the most common cause of female cancer-related ... this manuscript All authors read and approved the final manuscript 14 Funding Not applicable 16 Availability of data and materials The original raw data used in this study is available from the
Ngày tải lên: 17/06/2020, 18:24
Development and application of a raster based stormwater simulation model
... Minjiao Lu (Chairman) Associate Prof Toshiro Kumakura Associate Prof Tokuzo Hosoyamada Associate Prof Atsushi Rikimaru Associate Prof Guangwei Huang (External Examiner) Nagaoka, Japan, March, ... conventional DEM and laser-DEM at Toyanokata 69 Trang 105.23 Simulated water level at Takeoba in case of adding 60 m3/s at 5.24 Simulated water level at Toyanokata in case of adding 60 m3/s 5.25 Maximum ... The practical application showed that subcatchment separation is a difficult task because subcatchment boundary is not usually clear in urban areas, especially in flat areas In addition, human development
Ngày tải lên: 31/01/2021, 23:28
The application of a neural network to predict hypotension and vasopressor requirements non-invasively in obstetric patients having spinal anesthesia for elective cesarean section
... expansion and overlay of about 15 s of the original beat-by-beat AS data as well as the AS data re-sampled at 10 Hz Gratz et al BMC Anesthesiology (2020) 20:98 Page 4 of 15 Trang 5access, in contrast ... and was found to correlate with expected age- and drug-related changes in arterial stiffness [18] Visual examination of AS data of patients scheduled to undergo spinal anesthesia as part of a ... anesthesia for elective cesarean section (C/S) Irwin Gratz1*, Martin Baruch2, Magdy Takla1, Julia Seaman3, Isabel Allen4, Brian McEniry1and Edward Deal1 Abstract Background: Neural networks are increasingly
Ngày tải lên: 13/01/2022, 01:36
XÂY DỰNG ỨNG DỤNG ĐẶT LỊCH HẸN CẮT TÓC “E-HAIR” BUILDING THE APPLICATION OF A HAIR SCHEDULE “E-HAIR
... (2013) Applying Agile Methodology in Mobile Khawas, C., & Shah, P (2018) Application of Firebase in Android App Development Muthuswamy, S., Ganapathi, P., & S.Sathyanarayanan (2013) A survey on Mobile ... (1993) IEEE 830-1993 - IEEE Recommended Practice for Software Requirements Specifications Hoa Kỳ: Institute of Electrical and Electronics Engineers Kaleel, S B., & HariShankar, S (2013) Applying ... https://firebase.google.com/docs/auth/android/phone-auth?hl=en Google (2021) Download Android Studio Retrieved 12 2021, from https://developer.android.com/studio?gclid=CjwKCAiA78aNBhAlEiwA7B76p 2q2LG86exDrkpezNzFRHNxOYrLTo8G4q2pKHInjy-06TbkK4qqBahoCGGkQAvD_BwE&gclsrc=aw.ds
Ngày tải lên: 03/10/2022, 16:30
Examining the Effects of Water Use Regulations on Agriculture in the São Francisco River Basin, Brazil An Application of a Linked Hydro-Economic Model
... cost associated with land allocation It has a quadratic specification with parameters i and i and captures the increasing marginal cost associated with allocating larger amounts of land to a given ... University of Brasília, Brazila Marco Maneta – University of California, Davis, USAc Richard Howitt – University of California, Davis, USAb Stephen A Vosti – University of California, Davis, USAb Wesley ... irrigation using a water balance approach and agronomic production functions in a semi-arid area in Spain Cai and Wang (2006) , Cai, Ringler and You (2008), Marques et al (2006), and Ringler et al
Ngày tải lên: 18/10/2022, 22:17
Questions and Decisions- Application of a Cyclical Model for Prog
... Trang 1 !" # $ %% # Trang 2 !" # $ % %Trang 3 !" # $ % % 9! '( )* ' + Trang 4 !" # $ % %" , (9 ! '( Trang 5 !" # $ % % 5Trang 6 !" # $ % % ;Trang 7 !" ... <Trang 8 !" # $ % % DTrang 9 !" # $ % % = 2 Trang 10 !" # $ % %Trang 11 !" # $ % %( ( ;H 6 7 9D: <( " ( ===H 96 7 D: <( ( 9H< 6 7 5:;D( ( =H 55P< ( 5 ( Trang ... ===H<=6;7 5;<:D ( K # 9< D;DL ( 9H< 6 7 9; :D5( Trang 13 !" # $ % % 94 % / !U , 0 " $ C % " 4 3 * " B , " # " ' A " " 4 ' 8. " % 0 " 2 3 * M 7 B , "
Ngày tải lên: 26/10/2022, 16:27
Application of a Theory-Based Educational Intervention to Increas
... (Wessel et al., 2005) The American Academy of Pediatrics (AAP), American Academy of Pediatric Dentistry (AAPD), American Dental Association (ADA), and the American Association of Public Health Dentistry ... (Murthy & Mohandas, 2010; U.S Department of Health and Human Services [HHS], 2012) In fact, the American Academy of Pediatric Dentistry’s (AAPD) and American Academy of Pediatrics (AAP) recommends ... specialist, or physician assistant as allowed under state law, who provides, coordinates or helps a patient access a range of health care services” (Healthcare.gov, 2016) o Advanced practice
Ngày tải lên: 01/11/2022, 23:00
Development and application of a dot elisa assay for diagnosis of southern rice black streaked dwarf sisease in the field (khóa luận tốt nghiệp)
... study Name Sequence (5’-3’) Gene/ Vector Purpose S10-t-F CACCCCACATCGCGTCATCT diagnosis S10-t-R CCCATTTGAGCAGGAACTTCAC Actin-F TGATGGTGTCAGCCACACT diagnosis Actin-R TGGTCTTGGCAGTCTCCATT Trang ... Hunan, and has accurately identified SRBSDV-infected samples (Zhou et al., 2010) Another two specific pairs of primers which were S5-F1/S5-R2 TTACAACTGGAGAAGCATTAACACG-3'; 5'-ATGAGGTATTGCGTAACT GAGCC-3') ... groups to evaluate the statistical significance When homogeneity of variance was violated, Welch’s ANOVA Test was used instead of one-way ANOVA We have statistically compared the similar variance between
Ngày tải lên: 11/07/2023, 21:12
analyze the application of a variety of digital tools in tikis marketing activities
... is a part of the Lazada Group, a global online retailer withoffices in Malaysia, Singapore, Thailand, Indonesia,and the Philippines Currently, Alibaba Group is the owner of LazadaGroup German ... Philippines, Singapore, Thailand, and Vietnam -Lazada Vietnam was founded in March 2012 as an online marketplace offering products across a wide range of businesses Trang 7-Based on average monthly ... Lazada's Facebook fan page: Trang 15• The "Lazada Birthday Sale," an annual major event honoring the launch of this online retailsite.• "Lazada Mid-Year Festival": Major campaign with
Ngày tải lên: 08/05/2024, 15:47
topic select a company in vietnam analyse the application of a variety of digital tools introducing in the course in the companys marketing activities marketing mix
... [online] Available at: <https://www.similarweb.com/> [Accessed 7 July 2022] 2 GmbH, u., 2022 Analyze and improve fan pages - Fanpage Karma [online] Fanpagekarma.com Available at: <https://www.fanpagekarma.com/> ... indexes Email, display ads and emails are used less We can also see that Tiki use paid research most often III Fanpage: 1 Marketing mix to enhance fanpage: 1.1 Promotion: One of the factors that helps ... became a seagame champion, Shopee hired some famous soccer players in the U23 team for a marketing campaign Miss Vietnam also became the brand image of Shopee 5 Overview of Shopee: - Global rank
Ngày tải lên: 14/05/2024, 15:38