... Care and Use of Laboratory Animals) in accordance with the ARVO Statement for the “Use of Animals in Ophthalmic and Vision Research” and were approved by the local animal welfare committee According ... red) are located at the border of the vascularized and the avascular central zone in the superficial layer (s) Microglial cells (GFP, green) near vascular tufts are not activated as they are ramified ... microglia activation during the hypoxic phase correlates well with the peak of retinal revascularization and tuft formation The density of activated microglial cells (stained with an antibody raised...
Ngày tải lên: 19/06/2014, 22:20
... Sato A, Sakurada K, Kuge A, Ito M, Akasaka M, Kayama T: Spontaneous regression of primary intracranial germinoma: a case report No Shinkei Geka 2009, 37:277-282 Aydin F, Ghatak NR, Radie-Keane ... (CT) scan and a single cranial digital subtraction angiography (DSA) Fourteen days after the first MRI 12 and eight days after the CT scan and DSA, respectively - a pre-operative MRI was taken, ... radiation-induced rather than spontaneous: disseminated primary intracranial germinoma in a woman: a case report Journal of Medical Case Reports 2011 5:39 Submit your next manuscript to BioMed Central and take...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: " Anti-Fas mAb-induced apoptosis and cytolysis of airway tissue eosinophils aggravates rather than resolves established inflammation" docx
... h after each treatment (OVA/OVA+ IgG and OVA/OVA + anti- Fas mAb) (Figure 1) One group of animals with established eosinophilia treated with anti- Fas mAb was followed for 72 h after intra-nasal ... bronchoalveolar lavage (BAL) and dissection of the lungs and tracheobronchial airways Bronchoalveolar lavage (BAL) and quantification of luminal cells BAL was performed via a ligated tracheal cannula One ... treated animals, but were induced by anti- Fas mAb treatment (Figure 6A, and 6B) Additional signs of Fas-induced aggravation of airway inflammation The airway epithelium was grossly changed after...
Ngày tải lên: 12/08/2014, 18:22
Tài liệu Báo cáo khoa học: "Using Smaller Constituents Rather Than Sentences in Active Learning for Japanese Dependency Parsing" docx
... First we take languages similar to Japanese in terms of syntax, i.e., Korean and Mongolian These two languages are basically headfinal languages and have similar constraints in Section 3.2 Although ... pages 287–294 Masakazu Iwatate, Masayuki Asahara, and Yuji Matsumoto 2008 Japanese dependency parsing using a tournament model In Proc of COLING 2008, pages 361–368 Min Tang, Xaoqiang Luo, and ... informative for the classifier (c) Have annotators label the m examples (d) Train a new classifier on all labeled examples Japanese is a head final language and in written Japanese we usually hypothesize...
Ngày tải lên: 20/02/2014, 04:20
Tài liệu David prefers to live in the country rather than live in the city doc
... rather than” dùng cấu trúc “ prefer to something rather than (do) something else” với ngh a “ là” "Prefer … rather than"- cách dùng “verb phrase” nhằm nhấn mạnh "thích làm kia" => Dịch câu: David ... đến Ta có cụm từ: “in the country”- miền quê “in the city”- thành thị -“rather than”- là: Trong “ rather” trạng từ (abverb) có ngh a là, thích …hơn “than” liên từ ( conjunction) có ngh a hơn(để ... *David prefers to live in the country rather than live in the city Hình thức ngữ pháp : Cấu trúc “ prefer to something rather than (do) something else” – ( thích làm việc việc kia) Chúng ta quan...
Ngày tải lên: 26/02/2014, 00:20
17% of cell phone owners do most of their online browsing on their phone, rather than a computer or other device pdf
... sample frames and the relative sizes of each frame and each sample The second stage of weighting balances sample demographics to population parameters The sample is balanced to match national ... interviewers asked to speak with the youngest adult male or female currently at home based on a random rotation If no male/female was available, interviewers asked to speak with the youngest adult of ... the week to maximize the chances of making contact with a potential respondent Each number received at least one daytime call in an attempt to find someone available For the landline sample, interviewers...
Ngày tải lên: 29/03/2014, 20:20
ESPON 2013 DATABASE QUALITY RATHER THAN QUANTITY… potx
... Metadata Data and metadata The amount of data present in the ESPON database is the most obvious output of a project called “Database” It is also the easiest way to evaluate progress made at ESPON ... maintenance of both data and metadata in the ESPON Database Flexible database schemas have been designed and built for handling long term storage of statistical and spatial data, considering that ... figure) contains information about the dataset as a whole, about each individual indicator and about each individual value Metadata and data files are strongly linked, all indicators and scopes...
Ngày tải lên: 30/03/2014, 22:20
a universe from nothing why there is something rather than nothing
... galaxy had always been carried away with that velocity, we can work backward and figure out how long ago it would have been at the same position as our galaxy Since galaxies twice as far away ... lensing by galaxies rather than stars) Zwicky was an irascible character and way ahead of his time As early as 933 he had analyzed the relative motion of galaxies in the Coma cluster and determined, ... from us with faster velocities! When first presented with this remarkable fact-that almost all galaxies are moving away from us, and those that are twice as far away are moving twice as fast, those...
Ngày tải lên: 05/06/2014, 11:24
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
... Eur J Immunol 2006, 36:1434-1442 Claassen EA, Kant PA van der, Rychnavska ZS, van Bleek GM, Easton AJ, Most RG van der: Activation and inactivation of antiviral CD8 T cell responses during murine ... protein (amino acids 82 to 90) [10,25] (provided by the NIAID Tetramer Facility, Yerkes Regional Primate Research Center, Atlanta, GA) and fluorescein isothiocyanate-conjugated rat anti- mouse ... receptors, stained with the fluorescein isothiocyanate-conjugated anti- mouse CD8 monoclonal antibody, fixed and permeabilized with Cytofix/ Cytoperm (BD Biosciences), and stained with allophycocyanin-conjugated...
Ngày tải lên: 20/06/2014, 01:20
phân vân cách dùng rather than
... before "rather than" With practice and deeper understanding of the verb structures, you will soon learn how to apply the correct form In the meanwhile, try to remember as many as possible the examples ... rather than relating to people in the real work The verb structure is "to spend (time) doing something" To know when to use an infinitive, a noun, a noun phrase, or a V-ing after "rather than", ... of social isiolation ,a problem occasionally seen in people who spend too much time at their computer rather than relating to to people in the real world, People who spend too much time at their...
Ngày tải lên: 13/07/2014, 13:10
Báo cáo sinh học: "Process rather than pattern: finding pine needles in the coevolutionary haystack" doc
... virulence-resistance in Drosophila - parasitoid wasp rela tionships Heredity 2003, 90:84-89 Alcantara JM, Rey PJ, Manzaneda AJ, Boulay R, Ramirez JM, Fedriani JM: Geographic variation in the adaptive landscape ... Translating the outcomes of experimental studies such as that of Piculell et al [9] into real-world coevolutionary mosaics at the appropriate geographic scale remains a distant goal In the meantime, ... between populations to enable genes that are favorable to track the conditions in which they are favorable, and to allow the maintenance of genetic variation that would otherwise disappear [11,22]...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo y học: "In adult onset myositis, the presence of interstitial lung disease and myositis specific/associated antibodies are governed by HLA class II haplotype, rather than by myositis subtype" pdf
... determination of MSAs/MAAs Anti- PM-Scl, anti- Mi-2, anti- Ku, anti- U3RNP, anti- U1RNP, anti- SRP, and the anti- tRNA synthetases (anti- Jo-1, anti- PL-7, anti- PL-12, anti- EJ, anti- OJ, and anti- KS) were all ... some antibodies were not tested for (for example, anti- Ro52, the antibody against tertiary tRNA (anti- WS), and anti- translation factor (anti- KJ)), which may partly explain some of the genotypic association ... was considered sufficient for determination of the presence of the antibody The presence of anti- SRP, anti- U3RNP and the rare anti- tRNA synthetases (anti- PL-7, anti- PL-12, anti- EJ, anti- OJ, anti- KS)...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Anti-inflammatory effect of antidiabetic thiazolidinediones prevents bone resorption rather than cartilage changes in experimental polyarthritis" pps
... 5'-AAGATGGGTCACCAGCAGCTCTACTG-3' 67 59 Aggrecan Sense: 5'-ACACCCCTACCCTTGCTTCT-3' 124 58 59 56 92 56 433 58 362 57 Antisense: 5'-AGACGCGGCAAGAGCGAGAA-3' Antisense: 5'-AAAGTGTCCAAGGCATCCAC-3' PPAR-α ... 5'-GATGACCTGGAAAGTCCCTT-3' Antisense: 5'-CTTGAATGTTTCCCATCTCTT-3' PPAR-γ Sense: 5'-ATGGGTGAAACTCTGGGAGAT-3' Antisense: 5'-GGTAATTTCTTGTGAAGTGCT-3' Adiponectin Sense: 5'-AATCCTGCCCAGTCATGAAG-3' Antisense: ... 16 Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchiyama Y, Sumi K, Iguchi H, Ito S, Doi T, Hamakubo T, Naito M, Auwerx...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: "Excessive substance use in bipolar disorder is associated with impaired functioning rather than clinical characteristics, a descriptive study" pdf
... participated in planning of the study, supervised the data collection and statistical analyses PAR, AOB, SL and IA participated in the data collection All authors have made substantial contributions ... were trained based on the training program at UCLA (CA, USA) and participated in regular diagnostic consensus meetings A good inter-rater reliability was achieved with an overall kappa score ... 2007 69 American Psychiatric Association: Diagnostic and Statistical Manual of Mental Disorders Washington DC, USA: American Psychiatric Association 1994 70 Kay SR, Fiszbein A, Opler LA: The positive...
Ngày tải lên: 11/08/2014, 16:22
báo cáo khoa học: " The Washington Needle Depot: fitting healthcare to injection drug users rather than injection drug users to healthcare: moving from a syringe exchange to syringe distribution model" pps
... one block away, were presented to the City as part of an argument that no such permit was necessary It increasingly appeared that the demand for a municipal permit was a charade to mask opposition ... needles that a person can obtain within a given period and, as a result, significantly reduce the impact of NEPs [13] Various rationales are at the base of exchange approaches to needle programs The ... some have serious weight and heart problems, and some cannot read or write; all such challenges are approached with respect and a willingness to adapt and be creative The PHS Program Coordinator...
Ngày tải lên: 11/08/2014, 18:21
Báo cáo y học: "The International Sepsis Forum’s controversies in sepsis: my initial vasopressor agent in septic shock is norepinephrine rather than dopamine" pot
... resuscitation and dopamine administration In a randomized, double-blind trial, Martin and coworkers [5] compared norepinephrine with dopamine in 32 patients with septic shock Target MAP and CI was achieved ... Neviere and colleagues [9] found that gastric mucosal blood flow was Available online http://ccforum.com/content/7/1/3 decreased and intramucosal pH was unchanged with dopamine Meier-Hellman and ... Levy B, Bollaert PE, Charpentier C, Nace L, Audibert G, Bauer P, Nabet P, Larcan A: Comparison of norepinephrine and dobutamine to epinephrine for hemodynamics, lactate metabolism, and gastric tonometric...
Ngày tải lên: 12/08/2014, 19:21
Báo cáo y học: "The International Sepsis Forum’s controversies in sepsis: my initial vasopressor agent in septic shock is dopamine rather than norepinephrine" pptx
... Available online http://ccforum.com/content/7/1/6 Norepinephrine increases cardiac index This is an advantage of dopamine and actually a major advantage Although some studies have demonstrated ... Lowdose dopamine in patients with early renal dysfunction: a placebo- controlled randomised trial Australian and New Zealand Intensive Care Society (ANZICS) Clinical Trials Group Lancet 2000, ... increases portal lactate levels in sheep Additional points A number of additional points are worthy of mention First, dopamine has been shown in rats to increase the clearance of pulmonary oedema...
Ngày tải lên: 12/08/2014, 19:21
Báo cáo y học: "Analysis of XMRV integration sites from human prostate cancer tissues suggests PCR contamination rather than genuine human infection" ppt
... catctcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa catctcaaaaaaaaaaaaaaaaaaaaaaaaaa -******************************** B) EU981810 EU981678 CTCCTCAGAGTGATTGACTACCCAGCTCGGGGGTCTTTCAatatgtttgg CTCCTCAGAGTAATTAACTACCCAGCTCGGGGGTCTTTCAatatgtttgg ... gttttaatttatattctatttttcagaaacacaactaccatataaactga gttttaatttatattctatttttcagaaacacaactaccatataaactga ************************************************** EU981808 GU816103 gagagtatttttatttctttgggattttacaaagagcaatttaccatttt ... GU816103 gatataagtgctgtcatatagtaaatgcctaaataaaagtgttttgtgta gatataagtgctgtcatatagtaaatacctaaataaaagtgttttgtgta ************************** *********************** EU981808 GU816103 gttttaatttatattctatttttcagaaacacaactaccatataaactga...
Ngày tải lên: 13/08/2014, 01:20