analysis of macbeth act 1 scene 3

Báo cáo khoa học: Kinetic study of the HIV)1 DNA 3¢-end processing Single-turnover property of integrase docx

Báo cáo khoa học: Kinetic study of the HIV)1 DNA 3¢-end processing Single-turnover property of integrase docx

... 2.0 1. 5 1. 0 0.5 0.0 P 50 10 0 15 0 200 250 30 0 Time (min) N S P 15 30 60 90 12 0 15 0 18 0 240 30 0 10 [Product] (nM) 2.5 2.0 1. 5 1. 0 0.5 0.0 50 10 0 15 0 200 250 30 0 Time (min) C 0.25 0.2 r 0. 23 min )1) , ... 2 73 (2006) 11 37 ? ?11 51 ª 2006 The Authors Journal compilation ª 2006 FEBS 11 39 Single-turnover kinetics of HIV -1 integrase M Smolov et al 11 40 A 0.005 2000 0.0 03 15 00 1/ kobs (min) kobs (min -1) ... Journal 2 73 (2006) 11 37 ? ?11 51 ª 2006 The Authors Journal compilation ª 2006 FEBS 11 37 Single-turnover kinetics of HIV -1 integrase M Smolov et al The 3? ?-processing and strand transfer reactions can

Ngày tải lên: 16/03/2014, 13:20

15 375 0
Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

... (2002) Identifica- Analysis of ataxins and (Eur J Biochem 2 71) 31 6 9 12 2 12 3 12 4 12 5 12 6 12 7 12 8 12 9 13 0 13 1 13 2 13 3 13 4 13 5 13 6 13 7 13 8 tion of ter94, Drosophila VCP, as a modulator of polyglutamineinduced ... R., Nakayama, K & Ó FEBS 2004 10 4 10 5 10 6 10 7 10 8 10 9 11 0 11 1 11 2 11 3 11 4 11 5 11 6 11 7 11 8 11 9 12 0 12 1 Wakatsuki, S (20 03) Molecular mechanism of membrane recruitment of GGA by ARF in lysosomal protein ... Biochem 2 71, 31 5 5– 31 7 0 (2004) Ó FEBS 2004 doi :10 .11 11/ j .14 32 -10 33 .2004.04245.x Structural and functional analysis of ataxin-2 and ataxin -3 Mario Albrecht1,*, Michael Golatta2,*, Ullrich Wullner3 and

Ngày tải lên: 30/03/2014, 15:20

16 530 0
The Analysis of Firms and Employees Part 3 doc

The Analysis of Firms and Employees Part 3 doc

... 0 .10 41 0 .1 439 –0 .11 58 0.20 51 0 .34 78 0.49 21 0 .11 08 0.4 830 0. 739 2 –0 .19 22 –0.0789 0.2 010 0 .37 70 0. 91 43 0.0 438 0 .33 90 0. 834 3 –0.2005 0 .36 45 0 .19 41 0 .33 84 1. 06 73 1. 1598 0 .30 16 ... 0.00 13 0 .36 25 0.08 21 4.0840 4.8870 0.9420 3. 036 7 0.4848 0. 016 6 χ2 ? ?1. 7 432 0 .37 45 21. 6 633 χ2 –2. 032 9 0 .34 85 34 . 030 5 χ2 0. 13 9 8 –0.9496 0 .19 58 0.58 43 0. 510 1 2.6 415 0.47 51 ... 0.2 815 –0.2209 0.0596 –0.20 73 0 .16 08 0 .14 48 0 .16 27... 0 .16 70 3. 30 89 10 .6728 1. 98 01 0 .11 56 0.0689 0.0 011 0 .15 94 0. 733 9 –0. 032 8 0.0294 0.6202 0 .17 44 0.2264 0.2525 0. 035 5 0. 016 8 6. 033 4

Ngày tải lên: 06/07/2014, 14:20

26 354 0
Dictionary of Engineering Episode 1 Part 3 pdf

Dictionary of Engineering Episode 1 Part 3 pdf

... Abbreviated bbl 1 The unit of liquid volume equal to 31 . 5 gallons (approximately 11 9 liters) 2 The unit of liquid volume for petroleum equal to 42 gallons (approximately 15 8 liters) 3 The ... unit of dry volume equal to 10 5 quarts (approximately 11 6... ENG] 1 The characteristic of an object, such as a machine part, that is curved 2 A section of pipe that is curved 3 A ... Here for Terms of Use. backing backing [ CIV ENG ] 1. The unexposed, rough ma- backlog [ IND ENG ] 1. An accumulation of or- ders promising future work and profit. 2. An sonry surface of a wall that

Ngày tải lên: 21/07/2014, 15:20

25 530 0
Báo cáo toán học: "The cluster basis of Z[x1,1, . . . , x3,3]" potx

Báo cáo toán học: "The cluster basis of Z[x1,1, . . . , x3,3]" potx

... x b 1, 2 x f 3, 2 ∆ C 13 , 23 ∆ E 13 ,12 , x f 3, 2 x g 3, 3 ∆ C 13 , 23 ∆ E 13 ,12 , x a 1, 1 x b 1, 2 ∆ C 13 , 23 ∆ E 13 ,12 , x g 3, 3 ∆ C 13 , 23 ∆ D 13 , 13 ∆ E 13 ,12 , x a 1, 1 ∆ C 13 , 23 ∆ D 13 , 13 ∆ E 13 ,12 ... x 1, 1 , x 2 ,1 , ∆ 23 , 13 , Imm 2 13 abCp x 1, 1 , x 1, 2 , ∆ 13 , 23 , Imm 2 13 aBCp x 1, 1 , ∆ 23 , 13 , ∆ 13 , 23 , Imm 2 13 aBCD x 1, 1 , ∆ 23 , 13 , ∆ 13 , 23 , ∆ 13 , 13 gBCD x 3, 3 , ∆ 23 , 13 , ∆ 13 , 23 , ∆ 13 , 13 ... x 3, 2 , x 3, 3 , ∆ 13 , 23 , ∆ 13 ,12 abCE x 1, 1 , x 1, 2 , ∆ 13 , 23 , ∆ 13 ,12 gCDE x 3, 3 , ∆ 13 , 23 , ∆ 13 , 13 , ∆ 13 ,12 aCDE x 1, 1 , ∆ 13 , 23 , ∆ 13 , 13 , ∆ 13 ,12 defG x 2,2 , x 2 ,3 , x 3, 2 , ∆ 12 ,12

Ngày tải lên: 07/08/2014, 15:23

22 189 0
DESIGN OF MACHINERYAN INTRODUCTION TO THE SYNTHESIS AND ANALYSIS OF MECHANISMS AND MACHINES phần 3 pot

DESIGN OF MACHINERYAN INTRODUCTION TO THE SYNTHESIS AND ANALYSIS OF MECHANISMS AND MACHINES phần 3 pot

... by Sandor [1] and further developed by his students, Erdman,[2] Kaufman, [3] and Loerch et aI.l4,S] 5 .1 TYPESOF KINEMATIC SYNTHESIS Erdman and Sandor[6] define three types of kinematic ... path No 18 8 attempt is made in path generation to control the orientation of the link which contains the point of interest The coupler curve is made to pass through a set of desired ... be incapable of moving from one precision point to another due to the presence of a toggle position or other constraint This situation is actually no different than that of the graphical

Ngày tải lên: 08/08/2014, 13:20

93 397 0
The Gale Genetic Disorders of encyclopedia vol 1 - part 3 ppsx

The Gale Genetic Disorders of encyclopedia vol 1 - part 3 ppsx

... Neck, NY 11 0 21. ( 516 ) 466-4400. Fax: ( 516 ) 466-4484. asat@autism-treatment.org. Autism Society of America. 7 910 Woodmont Ave. Suite 30 0, Bethesda, MD 20 814 -3 015 . (3 01) 657-08 81 or (800) 3- AUTISM. ... 11 q 13 , 15 q22, or 16 q 21 In other families, researchers have linked BBS to either 2q 31 , 3p12, or 20p12 This last site is the location of the MKKS gene GALE ENCYCLOPEDIA OF ... NY 10 605 (888) 66 3- 4 637 ... 11 q 13 means chromosome number 11 , long arm, region 1, band 3 In studies of families with BBS, researchers have found that a significant number of

Ngày tải lên: 10/08/2014, 15:20

69 432 0
MULTI - SCALE INTEGRATED ANALYSIS OF AGROECOSYSTEMS - CHAPTER 1 potx

MULTI - SCALE INTEGRATED ANALYSIS OF AGROECOSYSTEMS - CHAPTER 1 potx

... LLC 36 9 36 9 36 9 37 3 37 7 38 0 39 2 39 2 39 8 402 4 03 408 410 412 417 417 417 418 420 11 .3 .1. 4 An Overview of the Organizational Structure of the Information... Domains 11 .2 .3 An Example of ... Spatial Analysis of Land Uses across Levels 11 .3 .1. 1 Definition of Lower-Level Characteristics and Household Types 11 .3 .1. 2 Definition of Household Types 11 .3 .1. 3 Moving to ... Selection of Useful Typologies 11 .2 .3 .1 The Frame Used to Compare Household and Village Types 11 .2 .3. 2 Characterization of Useful Household Typologies 11 .2 .3. 3 Analysis of the Strategies

Ngày tải lên: 11/08/2014, 21:21

41 342 0
báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt

báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt

... 21 5 29 38 - 10 0 ED029002 ACTGAAAAAAAATGAAGACTA BvMSat07 30 4 32 90 - 10 0 ED 019 7 43 GAAAAAATAAGTTCAGATCAGATCAGATCA BvMSat08 32 1 48 77 - 10 0 DX107266 GGGTCGGAATAAATCGGCTTTCGAAATGACTT BvMSat09 32 -39 ... Genet 2000, 10 0 (3) :447-4 53 Broun P, Tanksley SD: Characterization of tomato DNA clones with sequence similarity to human minisatellites 33 .6 and 33 .15 Plant Mol Biol 19 93, 23( 2):2 31 - 242 Hisatomi ... repeat size [bp] c 0 t -1 hits G/C-content [%] identity [%] EMBL accession representative monomere sequence BvMSat 01 10 7 34 40 - 10 0 ED0 230 89 AACTTATTGG BvMSat 11 15 1 41 36 - 10 0 DX580797 TAAATAGTCAAGCCC

Ngày tải lên: 12/08/2014, 03:21

14 270 0
Báo cáo y học: " Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus" pps

Báo cáo y học: " Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus" pps

... AmCPVS1 encoded p1 41 with segment 3 encoded proteins VP3, VP2 and a hypothetical protein of BmCPV1, DpCPV1 and LdCPV14, respectively [ 13 ,20, 21] . Function of VP3 protein of BmCPV1 is not exactly ... mass of ~14 1 kDa. Similarly, S3 consisted of 37 84 nucleotides having a long ORF of 36 30 nucleotides and could encode a protein of 12 10 amino acids with molecular mass of ~ 13 7 kDa. BLAST analysis ... http://www.virologyj.com/content/7 /1/ 1 81 Page 3 of 11 Analysis of recombinant AmCPV S1 and S3 encoded proteins expressed in E. coli and insect cells AmCPV S1 and S3 were expressed in E. coli M15 cells as insoluble 14 1 kDa

Ngày tải lên: 12/08/2014, 04:20

11 311 0
analysis of genes and genomes phần 3 pot

analysis of genes and genomes phần 3 pot

... of distinct... 35 00 30 00 2500 2000 15 00 10 00 750 500 (c) 12 500 (bp) Distance migrated (mm) 10 000 8000 6000 5000 4000 35 00 30 00 2500 2000 15 00 10 00 750 500 250 12 .00 12 .85 14 .55 16 .12 ... 12 .00 12 .85 14 .55 16 .12 18 .24 19 .74 21. 86 23. 97 27 .32 31 .72 38 .79 43. 29 50.25 59 .35 Fragment size (bp) Excellent separation of DNA molecules in the range of 200? ?15 000 bp is achieved ... ANALYSIS 2 Vector 5′-GAATTC -3? ?? 3? ??-CTTAAG-5′ 5′-G-OH PO 4 -AATTC -3? ?? 3? ??-CTTAA -PO 4 HO-G-5′ 5′-G-OH OH-AATTC -3? ?? 3? ??-CTTAA -OH HO-G-5′ 5′-GAATTC G AATTC -3? ?? 3? ??-CTTAA G CTTAAG-5′ 5′-GAATTC GAATTC -3? ??

Ngày tải lên: 14/08/2014, 11:21

50 355 1
Báo cáo y học: "Wound healing and inflammation genes revealed by array analysis of ''''macrophageless'''' PU.1 null mice" ppt

Báo cáo y học: "Wound healing and inflammation genes revealed by array analysis of ''''macrophageless'''' PU.1 null mice" ppt

... n = 13 8 n =17 2 n =38 n = 13 1 n =17 Late effector n=46 0 10 0 200 30 0 400 500 600 700 800 0 50 10 0 15 0 200 250 30 0 35 0 400 0 200 400 600 800 10 00 12 00 0 50 10 0 15 0 200 250 30 0 0 50 10 0 15 0 200 250 30 0 ... units) 3, 000 400 0 Hbb-b1 Krt2-6g Actc1 Rps27a Krt1-c29 Tpt1 S100a3 Apoe EST AA7 632 75 Hba-a1 EST AI8 517 62 Calm4 Krt1-24 Krt2-6a Krt2 -1 S100a3 Scd1 Krt1-2 Ncl Krt1 -3 Krt2 -18 Rps2 EST AI 019 679 Krt2 -10 ... Gbp3 EST C77009 EST AA1990 23 Sh3bgr1 Ars2 EST AI84 833 0 EST AA 816 1 21 EST AA846922 EST AA866655 Ppicap Elf3 Wsb1 Ifit3 Zac1 EST AI8440 43 EST AA755 234 Cyp2b19 Kitl Fin16 Ifit1 EST AI5 534 63 Fmr1 Czp-1

Ngày tải lên: 14/08/2014, 14:21

17 336 0
Chapter_8_Dynamic analysis of fydrodynamic bearings (1)

Chapter_8_Dynamic analysis of fydrodynamic bearings (1)

... Fig .3 shows the pressure distribution around the periphery of a journal Since, the pressure is created within the system due to rotation of the shaft, this type of bearing is known as self acting ... consequence of the shearing action of the high points However, due to the relative motion between the two surfaces, the welding too gets ruptured As a consequence of the phenomenon of the high ... completely separated by a film of fluid Since there is no contact between the surfaces, the properties of surface have little or no influence on the performance of the bearing The resistance to

Ngày tải lên: 10/07/2019, 09:53

27 1 0
Genetic analysis of phytoene synthase 1 (Psy1) gene function and regulation in common wheat

Genetic analysis of phytoene synthase 1 (Psy1) gene function and regulation in common wheat

... Biology (2 016 ) 16 :228 DOI 10 .11 86/s12870- 016 -0 916 -z RESEARCH ARTICLE Open Access Genetic analysis of phytoene synthase (Psy1) gene function and regulation in common wheat Shengnan Zhai1, Genying ... Genying Li2, Youwei Sun1, Jianmin Song2, Jihu Li1, Guoqi Song2, Yulian Li2, Hongqing Ling3, Zhonghu He1,4* and Xianchun Xia1* Abstract Background: Phytoene synthase (PSY1) is the most important ... Chinese Academy of Agricultural Sciences (CAAS), 12 Zhongguancun South Street, Beijing 10 00 81, China Full list of author information is available at the end of the article important source of carotenoids

Ngày tải lên: 22/05/2020, 04:56

15 44 0
Design, synthesis, ADME prediction and pharmacological evaluation of novel benzimidazole‑1,2,3‑triazole‑sulfonamide hybrids as antimicrobial and antiproliferative agents

Design, synthesis, ADME prediction and pharmacological evaluation of novel benzimidazole‑1,2,3‑triazole‑sulfonamide hybrids as antimicrobial and antiproliferative agents

... (2 018 ) 12 :11 0 Page of 14 Scheme? ?3? ?? Synthesis of? ?S,N-Bispropargylated benzimidazole 5  Scheme 4  Synthesis of S,N-bis (1, 2 ,3- triazole-sulfonamide)-benzimidazole hybrids 6a–f  The 1H NMR spectra of ... (IR, 1H NMR and 13 C NMR) Their IR spectra revealed the disappearance of peaks belonging to C≡C at 214 0  cm? ?1 and ≡C–H at 3 310  cm? ?1, confirming their involvement in the cycloaddition reaction ... (2 018 ) 12 :11 0 Al‑blewi et al Chemistry Central Journal https://doi.org /10 .11 86/s 130 65- 018 -0479 -1 RESEARCH ARTICLE Chemistry Central Journal Open

Ngày tải lên: 29/05/2020, 13:22

14 47 0
The effect of carbamic acid, (1,2,3-thiadiazole-4-ylcarbonyl)-hexyl ester on Peronophythora litchii infection, quality and physiology of postharvest litchi fruits

The effect of carbamic acid, (1,2,3-thiadiazole-4-ylcarbonyl)-hexyl ester on Peronophythora litchii infection, quality and physiology of postharvest litchi fruits

... Days of? ?storage (d) The inhibition of? ?mycelial growth (%) 0 mg/L 5 mg/L 10  mg/L 20 mg/L 10 0a 10 0a 10 0a 10 0a b a a 10 0a c 70. 91? ?±? ?11 .58 c b 10 0 10 0 b 74.25 ± 6 . 13 a 10 0a 10 0 b 74.87 ± 7.55 10 0a ... Liu et al Chemistry Central Journal (2 017 ) 11 :14 DOI 10 .11 86/s 130 65- 017 -0244-x Open Access RESEARCH ARTICLE The effect of? ?carbamic acid, (1, 2 ,3? ??thiadiazole‑4‑ylcarbonyl)‑hexyl ester on Peronophythora ... flesh of lithchi deteriorated and lost its market values [3] The pathogens of Peronophythora *Correspondence: xing 810 810 @16 3. com School of? ?Chemical Engineering, Xiangtan University, Xiangtan  411 105,

Ngày tải lên: 29/05/2020, 13:54

12 64 0
Design and Analysis of Clinical Study 1. Research Questions & Study Design

Design and Analysis of Clinical Study 1. Research Questions & Study Design

... Design and Analysis of Clinical Study Research Questions & Study Design Dr Tuan V Nguyen Garvan Institute of Medical Research Sydney, Australia The Utility of Science “The utility of all science ... Observation 1: Administration of penicillin – Observation 2: Cure of pneumonia • Null hypothesis is a statement which is opposite to the hypothesis of interest Example: – There is no effect of penicillin ... observation are often generalized • For example, “Penicillin cures pneumonia.” Hypotheses • Hypothesis of interest is a statement which specifies the nature of relationships between or more sets of observations

Ngày tải lên: 20/04/2022, 14:51

20 6 0
genetic analysis of phytoene synthase 1 psy1 gene function and regulation in common wheat

genetic analysis of phytoene synthase 1 psy1 gene function and regulation in common wheat

... Biology (2 016 ) 16 :228 DOI 10 .11 86/s12870- 016 -0 916 -z RESEARCH ARTICLE Open Access Genetic analysis of phytoene synthase (Psy1) gene function and regulation in common wheat Shengnan Zhai1, Genying ... Genying Li2, Youwei Sun1, Jianmin Song2, Jihu Li1, Guoqi Song2, Yulian Li2, Hongqing Ling3, Zhonghu He1,4* and Xianchun Xia1* Abstract Background: Phytoene synthase (PSY1) is the most important ... Chinese Academy of Agricultural Sciences (CAAS), 12 Zhongguancun South Street, Beijing 10 00 81, China Full list of author information is available at the end of the article important source of carotenoids

Ngày tải lên: 04/12/2022, 10:36

15 2 0
Fundamentals of Structural Analysis Episode 1 Part 3 pps

Fundamentals of Structural Analysis Episode 1 Part 3 pps

... (3/ 5) – F 4 (3/ 5) –F 1 = 0, F 1 = –6 kN. 2 1 2 3 6 kN 4 5 6 R y1 R x1 1 3 4 5 R x5 R y5 F 5 3 4 5 6 kN 3 F 6 3 4 5 2 F 5 F 4 F 1 3 5 4 3 4 5 Truss Analysis: Force Method, Part I by S. T. Mau 39 ... this example. F 2 3 F 3 0. 83 kN 1 0.5 kN 0 .17 kN F 1 0.62 kN x y 1 2 3m 2m 3 2m 1 2 3 6 kN 1. 5 m 4 5 6 3 4 5 3 4 5 4 5 Truss Analysis: Force Method, Part I by S. T. Mau 38 (1) Identify all force ... 4m 3m 8 kN 3 kN 3m 4m 4 kN 3m 4m 4 kN 3m 2m 6 kN 2m 1. 5m 1. 2 m 1. 6 m 0.9 m 2 m2 m 1. 2 m 0.9 m 0.7 m 5 kN 4 kN 0.9 m 0.9 m 0.7 m 4kN 0.9 m 5kN 1. 2 m 1m 1m 1 kN 2 m2 m 1m 1m 2 kN 2 m2 m 1m 1m 2

Ngày tải lên: 05/08/2014, 09:20

20 359 0
Numerical analysis of externally prestressed concrete beams part 1

Numerical analysis of externally prestressed concrete beams part 1

... ⎥ ⎦ ⎤ + ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ −+−−+ ⎢ ⎢ ⎣ ⎡ + ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ +− ⎟ ⎟ ⎠ ⎞ ⎜ ⎜ ⎝ ⎛ +−+−− ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ + + = 3 2 2 32 3 3 2 23 3 2 2 33 2 2 3 3 2 232 2 11 66 , 2 31 2 , 16 212 12 1, 2 31 2 12 1 12 1 1 x L x L L K x L K x L x L x L K x L x L K L x L K L K x L x L x L K L K L K N vy (3 .15 ) ⎥ ⎦ ⎤ ⎢ ⎣ ⎡ −= L x L x N u ,1 ... [] {} dK u u K KKSym KKK KKKK KKKKK KKKKKK M Q P M Q P c c cc ccc cccc ccccc cccccc = ⎪ ⎪ ⎪ ⎪ ⎭ ⎪ ⎪ ⎪ ⎪ ⎬ ⎫ ⎪ ⎪ ⎪ ⎪ ⎩ ⎪ ⎪ ⎪ ⎪ ⎨ ⎧ ⎥ ⎥ ⎥ ⎥ ⎥ ⎥ ⎥ ⎥ ⎦ ⎤ ⎢ ⎢ ⎢ ⎢ ⎢ ⎢ ⎢ ⎢ ⎣ ⎡ = ⎪ ⎪ ⎪ ⎪ ⎭ ⎪ ⎪ ⎪ ⎪ ⎬ ⎫ ⎪ ⎪ ⎪ ⎪ ⎩ ⎪ ⎪ ⎪ ⎪ ⎨ ⎧ 2 2 2 1 1 1 66 5655 464544 36 3 534 33 262524 232 2 16 1 514 1 31 2 11 2 2 2 1 1 1 θ ν θ ν (3. 24) Every element of matrix [ K c ] can be defined as below equations: ))(( 11 11 2 11 jjkk M j N k i jkjk c rrqq L Eb K ... therefore in urgent -36 - [] [] {} e uu e u dNd L x L x u = ⎥ ⎦ ⎤ ⎢ ⎣ ⎡ −= 1 where 3 2 2 33 2 3 3 2 22 3 2 2 33 3 2 3 3 2 22 2 11 6 212 , 236 , 1 6 212 1 124 , 236 1 12 1 1 x L x L L K L K L K x L x LL K x L x L K L x L K L K L K x L x LL K L K N vb + ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ −+ ⎟ ⎟ ⎠ ⎞ ⎜ ⎜ ⎝ ⎛ −−++ ⎢ ⎢ ⎣ ⎡ ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ +− ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ ++ ⎟ ⎟ ⎠ ⎞ ⎜ ⎜ ⎝ ⎛ +−+− ⎟ ⎠ ⎞ ⎜ ⎝ ⎛ + + = ...

Ngày tải lên: 07/11/2012, 11:04

96 514 1
w