alphabetize the properties of each rule in a css file

Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

... expands, the correct denotational relationship is maintained by expanding the image in the table using the ~-expression, and then finding the corresponding element in the model If the element in the ... to a model has been augmented with a table that contains each ~-expression and the ima6e of its denotation in the current stage of the dynamic model When the domain of the ~-expression expands, ... that was the denotation of the h-expression was not expanded in the same way as the image in this table, a new element corresponding to the expanded image is added to the model This table allows...

Ngày tải lên: 21/02/2014, 20:20

3 397 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency potx

THE CONSTITUTION OF LAW Legality in a Time of Emergency potx

... to interpreting the laws of apartheid illuminated debates in philosophy of law about the relationship between law and morality My main focus was on the statutory regime put in place to maintain ... an authoritarian past and in their regard it makes complete sense to talk about a choice to have the rule of law In contrast, in societies that are already governed by the rule of law, any attempt ... conception of the rule of law has to find a way of coordinating the roles of the judiciary and the other branches of government, when the latter are productively engaged in the rule -of- law project...

Ngày tải lên: 07/03/2014, 02:20

268 663 0
The Art of Grief The Use of Expressive Arts in a Grief Support Group pptx

The Art of Grief The Use of Expressive Arts in a Grief Support Group pptx

... meet the needs of the members and the facilitators is the initial planning, organization, and setting up of the group This initial stage can easily be bypassed in the interests of time and the ... logical relationship, and the feelings may come all at once in an inexplicable ball of raw emotion You may hear complaints of fatigue, exhaustion, lack of energy, pain, or inability to sleep All of ... Grief and the Sacred Art of Ritual Janet Shaw Rogers 129 Section III Alternative Art Forms, Programs, and Stories of Art and Healing Chapter 14 The Painters Deborah Koff-Chapin, Carol McIntyre, and...

Ngày tải lên: 29/03/2014, 04:20

324 640 0
báo cáo hóa học:" Quality of life and the impact of drug toxicities in a South African community-based antiretroviral programme" docx

báo cáo hóa học:" Quality of life and the impact of drug toxicities in a South African community-based antiretroviral programme" docx

... South Africa, there is an ongoing debate about whether or not the side-effect profile of HAART may adversely affect the HRQoL of HIVpositive individuals More data about the impact of HAART and HAARTrelated ... onto HAART and increasing survival among these patients, there is a growing need to understand the impact of HAART use on the quality of lives of HIVinfected individuals [4-8] There is a sizeable ... antiretroviral (ARV) therapy progressed to AIDS and died of their disease The rollout of highly active antiretroviral therapy (HAART) through national and provincial programmes has dramatically altered...

Ngày tải lên: 20/06/2014, 08:20

13 446 0
Báo cáo hóa học: " Influence of Landau level mixing on the properties of elementary excitations in graphene in strong magnetic field" docx

Báo cáo hóa học: " Influence of Landau level mixing on the properties of elementary excitations in graphene in strong magnetic field" docx

... dispersions in rather fast upon increasing a number of Landau levels taken into account Several lowest Landau levels are sufficient to obtain rather accurate results On the other hand, calculations in the ... points of the work and helped to finalize the manuscript AAS carried out the calculations and wrote the manuscript draft Both authors read and approved the final manuscript Competing interests The ... dispersions of magnetoplasmons in graphene calculated numerically are shown Results obtained without taking into account Landau level mixing, with taking into account a mixing of two or three lowest Landau...

Ngày tải lên: 22/06/2014, 00:20

23 251 0
Báo cáo toán học: "COMPOSITION SUM IDENTITIES RELATED TO THE DISTRIBUTION OF COORDINATE VALUES IN A DISCRETE SIMPLEX" pptx

Báo cáo toán học: "COMPOSITION SUM IDENTITIES RELATED TO THE DISTRIBUTION OF COORDINATE VALUES IN A DISCRETE SIMPLEX" pptx

... refer to as pictures of weight k A card of weight k is a pair consisting of a picture of weight k and a k-element subset of N that we will call the label set of the card A hand of weight n and size ... between the cardinality of the sets of hands and the cardinality of the decks For example, when dealing with labelled graphs, Dk is the set of all connected k-graphs whose vertices are labelled by ... k A card of weight k is a connected k-graph labelled by any k natural numbers Equivalently, a card can be specified as a picture and a set of natural number labels To construct the card we label...

Ngày tải lên: 07/08/2014, 06:20

14 349 0
Báo cáo lâm nghiệp: "Extended length rotation to integrate timber and pine nut production with the conservation of structural diversity in a Pinus pinea (L.) forest" pdf

Báo cáo lâm nghiệp: "Extended length rotation to integrate timber and pine nut production with the conservation of structural diversity in a Pinus pinea (L.) forest" pdf

... to calculate the most likely of the four rot risk classes as a function, for each fixed basal area, of the age and the dominant height of the stand, obtaining for each value of basal area a graphic ... distribution of the age of the dominant strata and the site index within the forest area can be seen in Figure The classification of the forest area in function of the stand age and the site index is ... number of pairs of samples ua and ua + d which distance from each other is within the distance lag centred at d, and z(ua ) and z(ua +d) are the values that the variable z takes at samplesua and ua...

Ngày tải lên: 07/08/2014, 16:20

9 462 0
Báo cáo toán học: "On the number of independent sets in a tree" pdf

Báo cáo toán học: "On the number of independent sets in a tree" pdf

... 0, j The number of matchings in a tree In this section, we turn to the number of matchings in a graph This is also known as the Hosoya index, or the Z-index in mathematical chemistry For a rooted ... set as a matching as well Applying the previous technique, we will show the following the electronic journal of combinatorics 17 (2010), #N18 Theorem For m ∈ N, B(m) = Z2 m There are formulae ... the electronic journal of combinatorics 17 (2010), #N18 Consider (T, r) obtained from T1 by joining a new vertex r to r1 Then ϕ(T, r) = (b, b + a) Hence, µ (a, b) ∈ D Inductively adding a leaf...

Ngày tải lên: 08/08/2014, 11:20

5 264 0
the age of turbulence adventures in a new world phần 4 docx

the age of turbulence adventures in a new world phần 4 docx

... companies, and the like Years in the making, the Financial Services Modernization Act finally did away with the Glass-Steagall Act, the Depression-era law that limited the ability of banks, investment ... of the challenge for the Treasury and the Fed, meanwhile, was to talk scores of the world's largest banks into not calling in their Korea loans All these initiatives came to a head at the same ... What set it off was the initial public offering of Netscape, a tiny two-year-old software maker in Silicon Valley that had al- most no revenues and not a penny of profits Netscape was actually...

Ngày tải lên: 09/08/2014, 19:22

57 397 0
the age of turbulence adventures in a new world phần 6 pdf

the age of turbulence adventures in a new world phần 6 pdf

... heavily invested in loans backed by real estate as collateral, as real estate prices soared When the turn came and prices cascaded downward, the collateral became inadequate But instead of calling ... which are already prominent in this book Australia and New Zealand are particularly interesting in how they developed after adopting market-opening reforms and gradually increasing ties with Asia, ... history and the culture it has spawned By culture, I mean the shared values of members of a society that are inculcated at an early age and that pervade all aspects of living Some aspects of a nation's...

Ngày tải lên: 09/08/2014, 19:22

57 404 0
the age of turbulence adventures in a new world phần 8 ppt

the age of turbulence adventures in a new world phần 8 ppt

... global trading partners, and that calls for a broader explanation of the causes of U.S income inequality Part of the explanation is the more elaborate welfare systems, especially in Europe, that ... But by then, they are all too visible The rapid pace of globalization of trade is being more than matched by an expanding degree of globalization of finance An effective global financial system ... stock, the fairly dramatic decline in the average age of the stock, and the creation as a consequence of a high degree of insecurity for those individuals in the labor markets who have to deal with...

Ngày tải lên: 09/08/2014, 19:22

57 396 0
the age of turbulence adventures in a new world phần 10 ppsx

the age of turbulence adventures in a new world phần 10 ppsx

... central planning throughout the world, with China and India in the vanguard The evidence of increasing property rights, and the rule of law more generally leading to increasing levels of material well-being ... implicit in one's current undertaking and pay a royalty to the originator of each one Rather than adopting that obviously unworkable approach, Americans have chosen instead to follow the lead of British ... decades ago was equal to that of China, but is now less than half of China's and still losing ground It is conceivable that India can undergo as radical a reform as China and become world-prominent...

Ngày tải lên: 09/08/2014, 19:22

48 338 0
Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" pot

Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" pot

... patient data and was a major contributor in writing the manuscript JR analyzed the patient data and contributed in writing the manuscript RP and BE analyzed and interpreted the patient data and were ... discharge, his bradycardia had reversed and his heart rate had increased to 85 beats/minute, which suggests that the initial bradycardia was likely related to the infusion of aminocaproic acid ... etiology of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated...

Ngày tải lên: 11/08/2014, 03:20

4 497 0
Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" potx

Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" potx

... patient data and was a major contributor in writing the manuscript JR analyzed the patient data and contributed in writing the manuscript RP and BE analyzed and interpreted the patient data and were ... discharge, his bradycardia had reversed and his heart rate had increased to 85 beats/minute, which suggests that the initial bradycardia was likely related to the infusion of aminocaproic acid ... etiology of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated...

Ngày tải lên: 11/08/2014, 07:20

4 397 0
Báo cáo khoa hoc:" Study of the impact of perilipin polymorphisms in a French population" docx

Báo cáo khoa hoc:" Study of the impact of perilipin polymorphisms in a French population" docx

... rs4578621 F : CAAGCTGGGTGCACTGGC 185 R : GAGAAATAGAGGAATTAACC rs6496589 F : CTGCCAACACTCG AGCTG 110 R : ACCTGACTCTTCCTTGTCT rs894160 F1 : GCTGAGACTGAGTCACATGC 403 R1 : GCTGAGACTGAGTCACATGC F2 : CTGTTTGTGGGGCTCCCTCG ... et al reported that the A allele was associated with enhanced basal and noradrenaline-induced lipolysis in human subcutaneous fat cells [7], it does not seem to have a major impact in human French ... Paris, France (available at http://gene canvas.ecgene.net/downloads.php) Statistical significance was defined at the 5% level Power calculation was done with the Epi Info 6.04 software available...

Ngày tải lên: 11/08/2014, 08:20

6 322 0
Báo cáo y học: "Role of vasopressin in the treatment of anaphylactic shock in a child undergoing surgery for congenital heart disease: a case report" docx

Báo cáo y học: "Role of vasopressin in the treatment of anaphylactic shock in a child undergoing surgery for congenital heart disease: a case report" docx

... hypoxia and lactic acidosis can maintain all the described pathophysiologic mechanisms and induce a relative deficiency in vasopressin plasma concentration further amplifying the vasoplegic scenario ... available experiences [12], the above described pharmacological rationale and the choice of avoiding escalating therapy with alpha agonists This pharmacological approach allowed us to titrate the ... effects of administered catecholamines [6] Epinephrine has been widely accepted to be the standard medical therapy to reverse cardiovascular collapse in anaphylaxis Because of its α and β adrenergic...

Ngày tải lên: 11/08/2014, 11:20

4 371 0
Báo cáo y học: " Exploring the optimum approach to the use of CT densitometry in a randomised placebo-controlled study of augmentation therapy in alpha 1-antitrypsin deficiency" pptx

Báo cáo y học: " Exploring the optimum approach to the use of CT densitometry in a randomised placebo-controlled study of augmentation therapy in alpha 1-antitrypsin deficiency" pptx

... Talecris and participated in the design of the study, in the collection, analysis and interpretation of data (CD was the statistician for the study), in the writing of the manuscript and in the ... EXACTLE trial was designed to explore the use of CT densitometry as an outcome measure for the assessment of plasma AAT augmentation therapy in individuals with AATD The analytical approach, and ... indicate a graded response to therapeutic augmentation of AAT The graded therapeutic effect that was most evident in the basal region may indicate that the progression of panlobular emphysema might...

Ngày tải lên: 12/08/2014, 14:20

10 439 0
Báo cáo y học: "The outcome of extubation failure in a community hospital intensive care unit: a cohort study" pot

Báo cáo y học: "The outcome of extubation failure in a community hospital intensive care unit: a cohort study" pot

... was associated with increased LOS in both the ICU and hospital after the initial extubation (Tables and 4) These findings corroborate data obtained in ICUs at tertiary R325 care centers, and ... surgical than in medical patients; of these the gastrointestinal and vascular services were more common in the failed extubation group Study cases were reintubated a median of 24 hours after extubation ... to, the same criteria used to evaluate weaning trial tolerance Definition of variables The primary exposure in this study was extubation failure, which was defined as reinstitution of mechanical...

Ngày tải lên: 12/08/2014, 20:20

6 332 0
w