agp as a potential biomarker for breast cancer

báo cáo khoa học: "Free Rhodium (II) citrate and rhodium (II) citrate magnetic carriers as potential strategies for breast cancer therapy" docx

báo cáo khoa học: "Free Rhodium (II) citrate and rhodium (II) citrate magnetic carriers as potential strategies for breast cancer therapy" docx

... sodium cacodylate buffer) The material was washed in distilled water and the block stained was performed for 12 h with 0.5% uranyl acetate at 4°C Then samples were dehydrated in a graded acetone ... doi:10.1186/1477-3155-9-11 Cite this article as: Carneiro et al.: Free Rhodium (II) citrate and rhodium (II) citrate magnetic carriers as potential strategies for breast cancer therapy Journal of Nanobiotechnology ... such as nuclear fragmentation, blebbing, disassembly of the actin cytoskeleton, and phosphatidylserine exposure in the plasma membrane These features suggest that Rh2(H2cit)4 has potential as an...

Ngày tải lên: 11/08/2014, 00:23

17 276 0
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

... 5'GGAGCUGCCCAUGAGAAAUdTdT-3' and antisense 5'AUUUCUCAUG GGCAGCUCCdTdT-3' The unrelated nonspecific dsRNAs as control were designed as following: sense 5'-GAACUUCAGGGUCAGCUUG CCdTdT-3' and antisense 5'-GGCAAGCUGACCCUGAAGUUCdTdT3' ... Baselga J: The EGFR as a target for anticancer therapy – focus on cetuximab Eur J Cancer 2001, 37:S16-22 Tamm I, Dorken B, Hartmann G: Antisense therapy in oncology, new hope for an old idea? ... of human cancer cells [9] Thus, it has recently emerged as an innovative target for the development of new cancer therapy, particularly for NSCLC [10] Recently, a monoclonal antibody against...

Ngày tải lên: 14/08/2014, 19:22

12 314 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae ... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana ... pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae Euglena gracilis Chloroplast DNA Chlorophyceae (green algae)...

Ngày tải lên: 23/03/2014, 15:21

11 505 0
Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

... the traditional activation cascade using C3 convertases or C5 convertases [13] As a result, C 5a may be generated via thrombin-mediated coagulation abnormalities that have been documented in anorexia ... power of our statistical analysis and make our data vulnerable to a statistical type II error Therefore, our data not allow for advocating complement serum levels as a new biomarker until definitively ... severe forms of anorexia nervosa Upon primary medical stabilization, patients are transferred to a psychiatrically based inpatient eating disorder program further treatment and follow-up Patients and...

Ngày tải lên: 09/08/2014, 01:21

6 445 0
Báo cáo y học: " Intracystic papillary carcinoma in a male as a rare presentation of breast cancer: a case report and literature review" potx

Báo cáo y học: " Intracystic papillary carcinoma in a male as a rare presentation of breast cancer: a case report and literature review" potx

... left breast He also had a significant family history for breast cancer including a maternal grandmother, two of his maternal aunts and a maternal first cousin diagnosed with breast cancer On examination, ... Intracystic papillary carcinoma in the male breast Breast J 2003, 9:249-250 Blaumeiser B, Tjalma WA, Verslegers I, De Schepper AM, Buytaert P: Invasive papillary carcinoma of the male breast ... Myoepithelial cell staining patterns of papillary breast lesions: from intraductal papillomas to invasive papillary carcinomas Am J Clin Pathol 2005, 123:36-44 Ganesan S, Karthik G, Joshi M, Damodaran...

Ngày tải lên: 11/08/2014, 19:21

4 322 0
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot

Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot

... plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; ... the E plasmid was 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG-3' and the 3' primer used for the U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified ... essential for Vif function J Biol Chem 2005, 280(19):18573-18578 Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T, Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H, Iwai K, Uchiyama...

Ngày tải lên: 13/08/2014, 05:21

13 254 0
BARRIER DISRUPTION IN STAT6VT TRANSGENIC MICE AS A POTENTIAL MODEL FOR ATOPIC DERMATITIS SKIN INFLAMMATION

BARRIER DISRUPTION IN STAT6VT TRANSGENIC MICE AS A POTENTIAL MODEL FOR ATOPIC DERMATITIS SKIN INFLAMMATION

... Sarasour, et al., 1995) The radial spread of SLS can elicit increased TEWL and decreased skin capacitance in areas adjacent to the application sites, as far as approximately 0.75cm away (Patil, ... technical aspects of this project For Dr Ravi Sahu, Dr Mohammed Al-Hassani, Dr Sarita Sehra, Dr Simarna Kaur, Qiaofang Yi, Davina A Lewis, Badri M Rashid, Evelyn T Nguyen, and Pamela Durant And finally, ... of asthma and allergic diseases The IL-4 pathway cascade is mediated through the activation of the latent transcription factor, signal transducer and activator of transcription (STAT6) The STAT...

Ngày tải lên: 24/08/2014, 12:37

50 209 0
Hydrogen peroxide as a potential biomarker of oxidative stress is there a reliable assay

Hydrogen peroxide as a potential biomarker of oxidative stress is there a reliable assay

... sample on DHR assay and comparison with DCFH assay 106 3.25 DHR assay recovery study and comparison with DCFH assay 107 3.26 Variations in H2O2 level throughout the day as measured by two assays ... 80 and 100 µM standards were used 2.2.11 Homovanillic acid (HVA) assay This is a peroxidase-based assay using homovanillic acid (HVA; Mr = 182.18) as the oxidizable substrate (Fig 3.10) HVA was ... The data, as given in Table 1.3, show that for every collection, there was a significant intra-sample variation between the assays The A2 2188 assay gave the lowest urinary H2O2 concentration values...

Ngày tải lên: 22/10/2015, 21:14

165 401 0
báo cáo khoa học: "Clinical relevance of "withdrawal therapy" as a form of hormonal manipulation for breast cancer" doc

báo cáo khoa học: "Clinical relevance of "withdrawal therapy" as a form of hormonal manipulation for breast cancer" doc

... 3d&tabid=2341] doi:10.1186/1477-7819-9-101 Cite this article as: Agrawal et al.: Clinical relevance of “withdrawal therapy” as a form of hormonal manipulation for breast cancer World Journal of ... treatment in advanced breast cancer Lancet 1974, 2:38-39 Hayward JL, Carbone PP, Heuson JC, Kumaoka S, Segaloff A, Rubens RD: Assessment of response to therapy in advanced breast cancer: a project ... & LAPC) 9.5+ (9-23) 9+ (2-23) M = Megestrol acetate; F = Fulvestrant; E = Exemestane; L = Letrozole; MBC = Metastatic Breast Cancer; LAPC = Locally Advanced Primary Breast Cancer; PR = Partial...

Ngày tải lên: 09/08/2014, 02:21

4 255 0
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

... Laboratories, PA, USA) The following primers were used: HSVtk, 5'-CCCATATCGGGGACACGTTATTT3' (forward) and 5'-GATAAAGACGTGCATGGAACGGAG-3' 5'-CCTGGATGCCGAACAAGGTTTA-3' (forward) CCAGCGTTCAATGCCTTCAAAC-3' TGGTGTTCCTATTGGCGGATGTCT ... GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG -3’ (forward) and 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ (reverse), ... mammary carcinoma cell line is a suitable experimental animal model for human mammary cancer When introduced orthotopically, it is capable of metastasis to several organs affected in breast cancer...

Ngày tải lên: 09/09/2015, 18:56

134 439 0
Báo cáo hóa học: "IThe tumor microenvironment of colorectal cancer: stromal TLR-4 expression as a potential prognostic marker" potx

Báo cáo hóa học: "IThe tumor microenvironment of colorectal cancer: stromal TLR-4 expression as a potential prognostic marker" potx

... Inflammation and breast cancer Balancing immune response: crosstalk between adaptive and innate immune cells during breast cancer progression Breast Cancer Res 2007, 9:212 11 Junankar SR, Eichten A, Kramer ... tubular or tubulovillous adenomas with low (29 cases) to high (5 cases) grade dysplasia (AD), and 53 infiltrating adenocarcinomas classified using TNM (ajcc, american joint committee on cancer, ... preneoplastic lesions are usually focal and mass forming There are also several differences in the sequences of molecular events leading from dysplasia to invasion in adenocarcinoma arising in IBD as...

Ngày tải lên: 18/06/2014, 16:20

16 217 0
Báo cáo hóa học: " A Novel Docetaxel-Loaded Poly (e-Caprolactone)/Pluronic F68 Nanoparticle Overcoming Multidrug Resistance for Breast Cancer Treatment" pot

Báo cáo hóa học: " A Novel Docetaxel-Loaded Poly (e-Caprolactone)/Pluronic F68 Nanoparticle Overcoming Multidrug Resistance for Breast Cancer Treatment" pot

... in human breast cancer cells and therefore have considerable potential for treatment of breast cancer Acknowledgments The authors are grateful for financial support from the National Natural Science ... phase The DCM was evaporated by nitrogen stream The analysis procedure was similar as for the measurement of EE Cell Culture In this research, human breast cancer cell lines MCF-7 cells of passages ... treatment of breast cancer, oval cancer, small and nonsmall cell lung cancer, prostate cancer, etc Its commercial formulation TaxotereÒ is formulated in high concentration of Tween 80, which has...

Ngày tải lên: 22/06/2014, 00:20

10 363 0
Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf

Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf

... increasing the safety and economic feasibility Our study will advance and extend the clinical application of MSC-based cell therapy for cartilage injury Materials and methods Rabbits Skeletally mature ... transplantation of cartilage In vivo analysis in rabbits repair by synovial mesenchymal stem cell transplantation in rabbits (a) Cell transplantation on a cartilage defect in a rabbit by the local adherent ... was measured Data expressed as the mean ± standard deviation (n = 3; P < 0.05 by Kruskal–Wallis test) ALCAM, activated leukocyte-cell adhesion molecule Available online http://arthritis-research.com/content/10/4/R84...

Ngày tải lên: 09/08/2014, 10:23

10 472 0
Báo cáo y học: "A filter-based feature selection approach for identifying potential biomarkers for lung cancer" pot

Báo cáo y học: "A filter-based feature selection approach for identifying potential biomarkers for lung cancer" pot

... the pathway interaction database Nucleic Acids Research 2009, 37: D674-D679 18 Thomas PD, Campbell MJ, Kejariwal A, Mi H, Karlak B, Daverman R, Diemer K, Muruganujan A, Narechania A: PANTHER: a ... setting for each classification algorithm was the same as in MAQC-II data set Table shows the maximum AUC value achieved by each combination of feature selection methods and classification algorithms ... biological roles For pathway analysis, we investigated associated terms in KEGG pathways [16], NCI-Nature pathway interaction database [17], and PANTHER (protein analysis through evolutionary relationships)...

Ngày tải lên: 10/08/2014, 09:22

8 368 0
Báo cáo khoa hoc:" Evaluation of triblock copolymeric micelles of δvalerolactone and poly (ethylene glycol) as a competent vector for doxorubicin delivery against cancer" doc

Báo cáo khoa hoc:" Evaluation of triblock copolymeric micelles of δvalerolactone and poly (ethylene glycol) as a competent vector for doxorubicin delivery against cancer" doc

... Matsumura Y, Suzuki M, Shimizu K, Goda R, Nakamura I, Nakatomi I, Yokoyama M, Kataoka K, Kakizoe T: NK105, a paclitaxelincorporating micellar nanoparticle formulation, can extend in vivo antitumour activity ... doxorubicin European Journal of Cancer 2000, 36:1149-1160 39 Upadhyay KK, Bhatt AN, Mishra AK, Dwarakanath BS, Jain S, Schatz C, Le Meins JF, Farooque A, Chandraiah G, Jain AK: The intracellular drug delivery ... the amount of formazan crystals formed was measured after h of MTT addition (10% v/v) by adding isopropyl alcohol and OD measurement at 570 nm The relative cell viability in percentage was calculated...

Ngày tải lên: 11/08/2014, 08:20

14 252 0
Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps

... below the pial surface Injection was carried out for 16 minutes and was performed using a Hamilton syringe Animals were monitored daily for neurological signs and weight loss At the appearance of ... type isolated from the spinal cord of a cow with astasia Archives of virology 2000, 145(11):2363-2370 Redaelli M, Cavaggioni A, Mucignat-Caretta C, Cavirani S, Caretta A, Donofrio G: Transduction ... English language correction and Italian Ministry of University and Scientific Research and the Fondazione Cariparma (Cassa di Risparmio di Parma, Italy) for funding contributions to the project Author...

Ngày tải lên: 12/08/2014, 02:20

6 233 0
Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx

Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx

... they had a baseline PC measure Day PC was classified as end of infusion If day measurement was not available, last observation carried forward values were used for classification These data were ... of randomization) and daily through to study day A central laboratory (Covance Central Laboratory Services, Indianapolis, IN, USA) performed all assays The PC activity assay was performed on a ... PTEE greater than 50% The PTEE for cardiovascular SOFA was 41% PC predicts cardiovascular changes downstream, and so it is expected that the cardiovascular SOFA would be a reasonable surrogate However,...

Ngày tải lên: 13/08/2014, 08:21

11 346 0
Báo cáo y học: "In silico evidence for the species-specific conservation of mosquito retroposons: implications as a molecular biomarker" ppt

Báo cáo y học: "In silico evidence for the species-specific conservation of mosquito retroposons: implications as a molecular biomarker" ppt

... quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus quinquefasciatus Identity strain strain strain strain strain strain strain strain strain strain strain JHB ... immunoconjugates is debatable In our opinion, in view of the devastating impact of diseases such as malaria on individuals and nations within malaria endemic areas, if such nanoparticles are shown ... three RST (AJ970181, AJ970201 and AJ970301) as queries against the 1,778 organismal and the human genome databases by way of BLAST-N calibrated at Expect (E) = 10, Filtration (F) at Default, Description...

Ngày tải lên: 13/08/2014, 16:20

8 260 0
Identification and functional validation of caldesmon as a potential gastric cancer metastasis associated protein

Identification and functional validation of caldesmon as a potential gastric cancer metastasis associated protein

... metastasis Stomach cancer ascites YCC Stomach cancer ascites Adenocarcinoma YCC Stomach cancer ascites Adenocarcinoma YCC Stomach cancer ascites Adenocarcinoma YCC Stomach cancer ascites Adenocarcinoma ... of distant metastasis cannot be assessed No distant metastasis Distant metastasis Table 1.1 TNM staging classification of gastric cancer 11 1.2.2 Metastasis Is a Multi-Step Process Metastasis, ... biomarkers for metastasis Activation of oncogenic signaling pathways is an important feature for cancer progression and metastasis Amplification of tyrosine kinase MET has been observed in certain gastric...

Ngày tải lên: 10/09/2015, 09:09

142 254 0
evaluate potential use of gut weed (enteromorpha sp.) as a food source for tilapia (oreochromis niloticus): affect on survival and growth

evaluate potential use of gut weed (enteromorpha sp.) as a food source for tilapia (oreochromis niloticus): affect on survival and growth

... world Tilapia production were Nile Tilapia Production of Tilapia in Vietnam has been increasing year by year; the farming area has been expanded In 2009, the area of tilapia reached 29,717 ha, production ... same as experiment Statistical analysis Data for all measured parameters were analyzed using Excel, and SPSS for Windows, Version 18.0 Variations from dietary treatment were compared by one way ANOVA ... 303-314 Asino.H,Ai.Q & Mai.K., 2010 Evaluation of Enteromorpha prolifera as a feed component in large yellow croaker (Pseudosciaena crocea, Richardson, 1846) diets.Aquaculture Research, 1-9 Bahnasawy,...

Ngày tải lên: 18/11/2015, 19:54

44 243 0
w