... create a table in the database and a primary key on the new table in a SQL Server database You can programmatically drop a table using the DROP TABLE statement in a similar way To drop the table ... Management Language (DML) Used to manipulate—select, insert, update, and delete—data in the database objects Database objects are defined using DDL The solution executes a DDL CREATE TABLE statement to ... syntax for each database varies slightly because of differences in database server capabilities and architecture For example, the CREATE TABLE statement for Oracle is different because Oracle...
Ngày tải lên: 21/01/2014, 11:20
... game is too easy So clearly we have to a better job to make an interesting game Reaching Goals An important part of a game is that there is a goal and the game challenges the player to try and ... highly balanced Each player has the same pieces and can make the same move The only problem is that one player can start and this is actually an advantage in chess But this is balanced out because ... the player off, making him stop playing And that is definitely not what you want to happen To avoid this it is crucial that, in the case of failure, the player always has the feeling he made a mistake...
Ngày tải lên: 27/06/2014, 12:20
Tài liệu How to Pitch a Brilliant Idea docx
... products and businesses—from Gladiator Garage Works, a line of modular storage units designed to reduce garage clutter; to Briva, a sink that features a small, high-speed dishwasher; to Gator Pak, an ... was increasingly evident that Darwin’s frontal assault on essentialism might be in some way related to the company’s current approach to organizational change Imposing a master plan created at ... explain in more detail what we mean by an innovation approach It is, simply, a broad management framework that helps companies turn ideas into financial returns Corporations use innovation approaches...
Ngày tải lên: 13/12/2013, 14:15
Tài liệu Adding value to traditional products of regional origin - A guide to creating a quality consortium pptx
... signatory states unless it already has national protection (Gerz y Bienabe in: Van de Kop et al 2006) a guide to creating a quality consortium Given such a varied and disparate global legal landscape, ... of a broad initiative whose ultimate aim was to register Kintamani Bali Arabika coffee as a geographical indication, organic certification was obtained first (Gerz in: Gerz et al 2008) 30 a guide ... agreements that are directly related to authenticity and tradition, and the more regulatory or conventional agreements that guarantee safety and facilitate product marketing (Casabianca et al 2000)...
Ngày tải lên: 18/02/2014, 21:20
Báo cáo khoa học: "A Term Recognition Approach to Acronym Recognition" pot
... specific factor nkx2 long-form candidate thyroid transcription factor in the tree We apply a number of validation rules (described later) to the candidate pair to make sure that it has an acronym-definition ... (e.g., extracting sequences of adjectives/nouns based on part-of-speech tags), and a stop-list The statistical analysis assigns a termhood (likelihood to be a term) to a candidate term by using ... Chang, James Pustejovsky, Eytan Adar, Harold R Garner, and Russ B Altman 2005 Biomedical term mapping databases Database Issue, 33:D289–D293 Carol Friedman, Hongfang Liu, Lyuda Shagina, Stephen...
Ngày tải lên: 17/03/2014, 04:20
A study on techniques to learn English idioms and proverbs
... different as chalk from cheese As dry as a bone / a stick / dust As dumb as a fish As fierce as a tiger As green as grass As hot as fire As light as a feather / air As loud as thunder As mute as a fish ... fish As old as the hills As pretty as a picture As quick as lightning As red as fire / blood / a cherry / a rose As sour as vinegar As strong as an ox As timid as a rabbit As wet as a drowned rat ... water: to manage to survive a difficult experience all at sea: in a state of confusion and disorder a drop in the ocean: a quantity too small to make any improvement to rest on ones oars: to take an...
Ngày tải lên: 21/03/2014, 09:17
Báo cáo khoa học: "A Supervised Learning Approach to Automatic Synonym Identification based on Distributional Features" ppt
... formalization of similarity-based approach would be essential, as pattern-based approach is enhanced with the supervised machine learning In this paper, we propose a novel approach to automatic ... Dekang Lin 1998 Automatic retrieval and clustering of similar words Proc of COLING/ACL 98, 786–774 Shachar Mirkin, Ido Dagan, and Maayan Geffet 2006 Integrating pattern-based and distributional ... bill* company* operation organization* The author would like to thank Assoc Prof Katsuhiko Toyama and Assis Prof Yasuhiro Ogawa for their kind supervision and advice References program DFEAT project...
Ngày tải lên: 23/03/2014, 17:20
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx
... CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides ... plants CD mutations not affect RNA cis-elements Many RNA viruses contain RNA cis-elements that can affect replication To test if amino acid changes (F31 3A, F35 7A, and W405) may have inactivated ... REP/F1 -A F1-313-F2 P31 7A- 989R N32 3A- 1007R L32 5A- 1014R REP/Y -A 1044R-C /A REP/F -A REP/D -A MUTPMV-1236R REP/W -A CCCCAGCGGCTTCGTTCTTTGC GGAACCCCAGCAAACTCGTTCTTTGC CTGTGGGTTTTGCAACCCCAGCG CAGCCAACTGGGCAGCCTCTGTG...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: "Short-term locomotor adaptation to a robotic ankle exoskeleton does not alter soleus Hoffmann reflex amplitude" doc
... Evelyn Anaka, Danielle Sandella, Catherine Kinnaird and members of the Human Neuromechanics Laboratory for assistance in collecting data We also thank Anne Manier for help with fabricating the ... be used to induce an alteration of reflex responses during human walking, it would have considerable potential as an aid for gait rehabilitation in addition to reducing manual assistance from ... section A metal hinge between the sections allowed free sagittal plane rotation of the ankle joint Two artificial pneumatic muscles attached to the exoskeleton provided substantial plantar flexor torque...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" The psychological context of quality of life: a psychometric analysis of a novel idiographic measure of bladder cancer patients’ personal goals and concerns prior to surgery" pot
... waiting [9,10,2,11] Such rating scales are widely accepted and used, and considerable normative data are available, especially pertaining to general aspects of cancer-related quality of life and ... the Rapkin and Schwartz (2004) approach to permit a wider variety and number of responses to emerge, and to allow individuals to directly evaluate their progress toward attainment of each identified ... employment status, religious participation and affiliation, disease and treatment history, and co-morbidities Analysis Plan Our analysis included examination of patient characteristics and quality of...
Ngày tải lên: 20/06/2014, 15:20
RFID-A GUIDE TO RADIO FREQUENCY IDENTIFICATION pot
... to virtually anything, from a pallet, to a newborn baby, to a box on a store shelf 2.2 RFID TAGS The basic function of an RFID tag is to store data and transmit data to the interrogator At its ... most basic, a tag consists of an electronics chip and an antenna (see Figure 2-2) encapsulated in a package to form a usable tag, such as a packing label that might be attached to a box Generally, ... RFID INTERROGATORS An RFID interrogator acts as a bridge between the RFID tag and the controller and has just a few basic functions • • • • Read the data contents of an RFID tag Write data to...
Ngày tải lên: 27/06/2014, 15:20
The making of a big idea: Short guide to make an Application
... mb ro ee ’ s a A ETR EL BTE WHE ? b t lase mb r n akitee u a y rme e a d s, h r w s RSA C EER H s rwt ail bt f t t i lt io a h te PA LN n x s p maea e tt k e WHT O O NE? A D YU ED ak o r l s ... O ITG AIN DPOM N NERT & ELY ET O WH D YU ED O O O NE? a dte ,h k b u n h n ti a o t n AO E LN w cn a as oi e a l y d t tw Ou Ta r e m: Ae l x DSG G Y EIN U Dn a CO E DVLPR LST EE E O Mat rn ... s B A DN & RAIE TAEY R N IG C ET SRTG V IFR AIN R HTCU E NO M T A C I TR O E VS A UDSG IU L IEIN FO T N DVLP ET R N- D EE M N E O TC NC L EER H EPO AIN EH IA RSA C & XLRT O B C - D EE P ET A KE...
Ngày tải lên: 10/07/2014, 14:18
Báo cáo toán học: " A BINOMIAL COEFFICIENT IDENTITY ASSOCIATED TO A CONJECTURE OF BEUKERS" ppsx
... sum satisfies a certain (homog.) third order linear recurrence equation To find the recurrence, and its proof, download the Maple package EKHAD and the Maple program zeilWZP from http://www.math.temple.edu/~ ... A BINOMIAL COEFFICIENT IDENTITY ASSOCIATED TO A CONJECTURE OF BEUKERS Scott Ahlgren, Shalosh B Ekhad, Ken Ono and Doron Zeilberger Using the WZ method, a binomial coefficient identity ... zeilWZP(k*(n+k)!**2/k!**4/(n-k)!**2,F,G,k,n,N): References [A- O] [B] [Z] S Ahlgren and K Ono, A Gaussian hypergeometric series evaluation and Ap´ry number congruences (in prepae ration) F Beukers, Another congruence for Ap´ry numbers, J...
Ngày tải lên: 07/08/2014, 06:22
Báo cáo khoa học: " Prospective phase II study of preoperative short-course radiotherapy for rectal cancer with twice daily fractions of 2.9 Gy to a total dose of 29 Gy - Long-term results" ppt
... writing and drafting of the manuscript JW: conception and design of the study, acquisition of data and data analysis AT: acquisition of data and data analysis DW: acquisition of data and data analysis ... The authors declare that they have no competing interests Authors' contributions All authors read and approved the final manuscript MG: acquisition of data and data analysis, statistical analysis, ... survival [1] Significant progress has been made in surgical, radiation and medical therapy: total mesorectal excision (TME) has become a surgical standard [2] and neoadjuvant radiotherapy (±...
Ngày tải lên: 09/08/2014, 10:20
Rfid a guide to radio ffrequency identification phần 5 docx
... of JTC1 was formed to address the standardization of RFID Automatic Identification and Data Capture (AIDC) technologies, as well as item management technologies Some of these standards have been ... RFID mandates Other major retailers, such as Target and Metro AG, the leading retailer in Germany, have also adopted the standards 90 RFID REGULATIONS AND STANDARDS developed by EPCglobal As a ... RFID REGULATIONS AND STANDARDS TABLE 7-3 Published EPC Standards EPC Tag Data Standards UHF Class Specifications UHF Class Specifications HF Class Specifications Radar Protocol Savant Specifications...
Ngày tải lên: 09/08/2014, 19:22
Rfid a guide to radio ffrequency identification phần 6 docx
... Oklahoma The lipstick had RFID tags attached that allowed the inventory to be tracked leaving the shelf The test also utilized a video camera that allowed researchers at Proctor & Gamble headquarters ... VeriChip to the healthcare industry and the public as a personal identification and medical record storage device The FDA approval of the human implant VeriChip raised many ethical, access, and data ... healthcare database Ethical, access, and data security and safety concerns include: DATA MANAGEMENT • • • • • 109 Does the person/reader have the proper authorization to access the ADSmaintained...
Ngày tải lên: 09/08/2014, 19:22