adding a menu item to an existing menu

Hướng dẫn bói bài Tarot Real tarot  a modern approach to an ancient art

Hướng dẫn bói bài Tarot Real tarot a modern approach to an ancient art

... great success as an outcome, and by drawing an action card as well, you can discover the best way to proceed towards that goal 16 Chapter - A Journey through the Major Arcana The Major Arcana are ... will agree that this card can be seen as a warning to look carefully at your financial situation, and to be cautious in all matters relating to money Two of Wands Wands are the suit of energy and ... sculptor stands upon a pew, with a mallet and chisel in his hands A priest and an architect with blueprints in his hands stand near this craftsman, discussing the changes they need to make to the...

Ngày tải lên: 17/02/2016, 11:57

92 354 1
An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

... examine the nature and function of language in detail All of these, according to Ferguson (1972), agree on two points: language is an answer to a need to communication, and language forms are ... until the major part of the grammatical system has been learned The structural syllabus is very familiar to language teachers, and it has several advantages However, structural syllabus has its shortcomings ... in a given speech act Bygate (1987) considers speaking as an undervalued skill in many ways The reason is that almost speakers can speak, and so take speaking skill too much for granted He also...

Ngày tải lên: 07/09/2013, 13:19

43 592 1
Exposing an Existing Application As a Portlet

Exposing an Existing Application As a Portlet

... Page 308 Chapter 13 Installing To install the YAZD forums, you will need to acquire a database, with a JDBC driver, and an application server such as Tomcat You will also need a copy of the YAZD ... directing to an external page, and then rewriting those links appropriately Displaying Screens in a Portlet Our application is to operate as a single portlet, but we want to base it on an application ... login.jsp We have removed the search facility from our design, so search.jsp can go We also want our page to be an HTML fragment rather than a full page, so the header and footer pages can be deleted...

Ngày tải lên: 05/10/2013, 04:20

32 290 0
Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams

Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams

... team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and the requirements analysts and ... software packages), hardware and software implementation (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software ... of Idea Group Inc is prohibited Managing and Practicing OD in an IT Environment 261 how to proceed with the validated data, and the action plan and goals they create can be compared against...

Ngày tải lên: 24/10/2013, 08:20

33 570 0
Tài liệu Converting a DataSet to an ADO Recordset docx

Tài liệu Converting a DataSet to an ADO Recordset docx

... ""; xmlDoc.LoadXml(adoXml); // Create a namespace manager for the XML document XmlNamespaceManager nm = new XmlNamespaceManager(xmlDoc.NameTable); // Add ADO prefixes nm.AddNamespace("s", "uuid:BDC6E3F0-6DA3-11d1 -A2 A3-00AA00C14882"); ... // Load the Orders data into a table in a DataSet DataSet ds = new DataSet( ); SqlDataAdapter da = new SqlDataAdapter(sqlText, ConfigurationSettings.AppSettings["Sql_ConnectString"]); da.Fill(ds, ... schema section and the data section The schema section is required and contains detailed metadata about each column in the table The data section contains an element for each row Column data is stored...

Ngày tải lên: 14/12/2013, 18:16

15 392 0
Tài liệu Cấp giấy phép thầu cho nhà thầu nước ngoài là tổ chức nhận thầu các gói thầu thuộc dự án nhóm A và các dự án đầu tư thuộc địa bàn 2 tỉnh trở lên doc

Tài liệu Cấp giấy phép thầu cho nhà thầu nước ngoài là tổ chức nhận thầu các gói thầu thuộc dự án nhóm A và các dự án đầu tư thuộc địa bàn 2 tỉnh trở lên doc

... công trình xây dựng Tài liệu đính kèm viết Mau don xin phep thau T1TW.doc(Mau don xin phep thau T1TW_1249971538514.doc) Tải Mau bao cao T1TW.doc(Mau bao cao T1TW_1249971538274.doc) Tải ... kiện 3: Trong trường hợp giao thầu (do thắng thầu thông qua đấu thầu chọn thầu) nhà thầu nước phải liên danh với nhà thầu Việt Nam phải sử dụng nhà thầu phụ Việt Nam (trừ trường hợp Thủ tướng ... phép theo quy định pháp luật Việt Nam) d) Yêu cầu điều kiện 4: Phải cam kết thực đầy đủ quy định pháp luật Việt Nam có liên quan đến hoạt động nhận thầu Việt Nam 1.11 Căn pháp lý thủ tục hành...

Ngày tải lên: 24/01/2014, 19:20

3 343 0
Tài liệu Exporting the Results of a Query to an Array pdf

Tài liệu Exporting the Results of a Query to an Array pdf

... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names ... = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected...

Ngày tải lên: 26/01/2014, 10:20

5 311 0
Tài liệu Controlling Fine Particulate Matter Under the Clean Air Act: A Menu of Options pdf

Tài liệu Controlling Fine Particulate Matter Under the Clean Air Act: A Menu of Options pdf

... Fine Particulate Matter Under the Clean Air Act: A Menu of Options About STAPPA and ALAPCO The State and Territorial Air Pollution Program Administrators (STAPPA) and the Association of Local Air ... U.S and California (and one area in Montana) currently exceed EPA’s National Ambient Air Quality Standards (NAAQS) for PM2.5, and states must submit State Implementation Plans (SIPs) by April ... sets a cap on total emissions of a particular pollutant from the regulated industry sector and creates authorizations (“allowances”) to emit a specified quantity of that pollutant Allowances are...

Ngày tải lên: 17/02/2014, 11:20

291 385 0
A Special Addition to Staying Healthy: An English Learner’s Guide to Health Care and Healthy Living ppt

A Special Addition to Staying Healthy: An English Learner’s Guide to Health Care and Healthy Living ppt

... options to avoid pregnancy Once a woman is pregnant, her body will go through many changes Pregnant women also have many options to deliver and to take care of their babies Pregnancy If a woman has ... contain cancer, and they not spread (Benign means “not dangerous.”) Malignant tumors are cancer They can kill you It is very important to treat malignant tumors as soon as possible (Malignant means ... Health A Special Addition to Staying Healthy: An English Learner’s Guide to Health Care and Healthy Living Naomi Soto, Maria Koonce, Gregory Smith Florida Literacy Coalition Florida’s Adult and...

Ngày tải lên: 05/03/2014, 13:20

37 549 0
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an ... from an 83-year-old man and a 71.0 g sample of occipital cortex from a 85-year-old man with a short (25 h) post mortem delay RNA isolation, reverse transcription and 5Â-RACE Total RNA was isolated ... trypsinogens are predictors of distant metastasis and survival in early-stage non-small cell lung cancer Cancer Res 64, 55645569 21 Marsit CJ, Karagas MR, Danaee H, Liu M, Andrew A, Schned A, Nelson...

Ngày tải lên: 07/03/2014, 10:20

11 470 0
Báo cáo khoa học: Investigations into the ability of an oblique a-helical template to provide the basis for design of an antimicrobial anionic amphiphilic peptide pot

Báo cáo khoa học: Investigations into the ability of an oblique a-helical template to provide the basis for design of an antimicrobial anionic amphiphilic peptide pot

... Moffat, National Research Council, Ottawa, Ontario, Canada The band shapes of the single components are superpositions of Gaussian and Lorentzian band shapes Best ts were obtained by assuming a ... of action of linear amphipathic alpha helical antimicrobial peptides Biopolymers 47, 451463 48 Tytler EM, Segrest JP, Epand RM, Nie SQ, Epand RF, Mishra VK, Venkatachalapathi YV & Anantharamaiah ... Instruments, Madison, WI, USA), and, for each sample, absorbance spectra were produced For these spectra, water bands were subtracted, and the evaluation of peptide band parameters (peak position, band...

Ngày tải lên: 07/03/2014, 12:20

12 691 0
Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt

Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt

... 47th Annual Meeting of the ACL and the 4th International Joint Conference on Natural Language Processing of the AFNLP, ACL ’09, pages 513–521 Mitch Marcus, Beatrice Santorini, and Mary Ann Marcinkiewicz ... AAAI, pages 412–418 C Kruengkrai, K Uchimoto, J Kazama, Y Wang, K Torisawa, and H Isahara 2009 An error-driven word-character hybrid model for joint chinese word segmentation and pos tagging ... words are generated with respect to the partially tagged character sequence A character tagged with B always occurs at the beginning of a possible word Table illustrates the constrained and raw...

Ngày tải lên: 07/03/2014, 18:20

9 427 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

... D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢) and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer ... (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse primer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D45–47; forward primer ... amino acids) than that of other well characterized bipartite NLSs (Table 1) Searching SWISSPROT and standard databases by PROSITE, and analyzing data deposited at the PredictNLS server (http://maple.bioc...

Ngày tải lên: 18/03/2014, 01:20

8 1,1K 0
Workplace Writing Skills Developing Clarity and Accuracy A Resource to Supplement Existing Published Materials doc

Workplace Writing Skills Developing Clarity and Accuracy A Resource to Supplement Existing Published Materials doc

... direct language? What you feel as a reader when you read less direct language? When is it appropriate to use polite, indirect language? What are the advantages and disadvantages of indirect language? ... What are the advantages and disadvantages of a multi-cultural workforce? What can the top administration learn from the staff? How you suggest they can learn? What can be done to encourage more and ... appropriate to use direct language? What are the advantages and disadvantages of direct language? When can communication be direct as well as polite? Indirect Language What you feel as the writer...

Ngày tải lên: 19/03/2014, 08:20

52 508 0
Báo cáo khoa học: "Learning a Compositional Semantic Parser using an Existing Syntactic Parser" pot

Báo cáo khoa học: "Learning a Compositional Semantic Parser using an Existing Syntactic Parser" pot

... Linguistics (ACL-07), pages 960–967 Ruifang Ge and Raymond J Mooney 2005 A statistical semantic parser that integrates syntax and semantics In Proc of 9th Conf on Computational Natural Language Learning ... We have presented a new approach to learning a semantic parser that utilizes an existing syntactic parser to drive compositional semantic interpretation By exploiting an existing syntactic parser ... Blackburn and Johan Bos 2005 Representation and Inference for Natural Language: A First Course in Computational Semantics CSLI Publications, Stanford, CA Yusuke Miyao and Jun’ichi Tsujii 2002 Maximum...

Ngày tải lên: 23/03/2014, 16:21

9 278 0
A Primer on Developing An E-Business Strategy - Submitted to: First Stop Business Information Center docx

A Primer on Developing An E-Business Strategy - Submitted to: First Stop Business Information Center docx

... loans, auto loans, credit card loans, Small Business Administration guaranteed loans, commercial mortgage loans, and certain other loans As part of the program, Treasury provided through TARP authorities ... for TARP equity, loan, and guarantee transactions were made using available data and methods to capture additional potential costs related to uncertainty around the expected cash flows to and ... Bureau’s approach to nonbank examination will be the same as its approach for banks In October 2011 and January 2012, respectively, the Bureau released a general CFPB Examination Manual to guide...

Ngày tải lên: 29/03/2014, 19:20

76 358 0
Báo cáo khoa học: "A Generic Approach to Parallel Chart Parsing with an Application to LinGO" pdf

Báo cáo khoa học: "A Generic Approach to Parallel Chart Parsing with an Application to LinGO" pdf

... Engineering, 6(1):1–18 [Manousopoulou et al.1997] A. G Manousopoulou, G Manis, P Tsanakas, and G Papakonstantinou 1997 Automatic generation of portable parallel natural language parsers In Proceedings ... Kentaro Torisawa, and Jun’ichi Tsujii 2001 An agentbased parallel HPSG parser for shared-memory parallel machines Journal of Natural Language Processing, 8(1), January [Nurkkala and Kumar1994] Tom ... consists of two parts: MACAMBA and CaLi MACAMBA stands for Multi-threading Architecture for Chart And Memoization-Based Applications The MACAMBA framework provides a set of objects that implement...

Ngày tải lên: 31/03/2014, 04:20

8 335 0
Bacillus thuringiensis   a new perspective for an induced protection to coffee leaf rust

Bacillus thuringiensis a new perspective for an induced protection to coffee leaf rust

... Several authors have found that plants can be induced to be resistant against infectious agents when properly stimulated (Kuc 1985, DEAN and Kuc 1985, ScHOENBECK et al 1980), and that plants may ... cotton and sprayed on the abaxial (under) leaf surface with 152 DAGMAR S ROVERATTl, ANA REGINA R TEIXEIRA and WALKYRIA B C MORAES the inducer preparation, using nitrogen as the propellent gas, ... leaf (Table 3) The systemic effect also spread laterally from one leaf of the pair to the other leaf of the same pair (Table 3), and in the same leaf from the adaxial to the abaxial surface (Table...

Ngày tải lên: 05/05/2014, 08:45

12 423 0
A Systems Approach to Conduct an Effective Literature Review in Support of Information Systems Research

A Systems Approach to Conduct an Effective Literature Review in Support of Information Systems Research

... understanding of the concepts presented by Han and Kamber Han and Kamber (2001) suggest an evolution that moves from data collection and database creation, towards data management, and ultimately, ... evolution that moves from data collection and database creation, towards data management, and ultimately, data analysis and understanding Figure 7: Pre-comprehension level mastery Although the citation ... ultimately, data analysis and understanding For example, data processing is a base function enabling manipulation and aggregation of data, thus facilitating searching and retrieval Figure 8:...

Ngày tải lên: 02/06/2014, 09:38

32 470 0
a means to an end the biological basis of aging and death apr 1999

a means to an end the biological basis of aging and death apr 1999

... human death have changed dramatically during our history as a species, but maximum lifespan, as far as we can tell, has not As the twentieth century draws to a close, cardiovascular disease and ... accidental death T h e gradual physical weakening that accompanies aging will make an animal more likely to be caught by a predator; diminished immune capacity can make us more suscep8 AGING S ... age 30 Skin and hair Loss of subcutaneous fat; appearance of wrinkles, pigmentation Graying of hair at all body sites; loss on top of head; some facial hair may increase Nails thicken Heart and...

Ngày tải lên: 11/06/2014, 05:26

246 672 0
w