adding a line to control the mainsail

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified...

Ngày tải lên: 19/02/2014, 17:20

12 620 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

... enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has to a brand” Yoo and Donthun (2001) also ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together ... competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand commonly provide the...

Ngày tải lên: 24/09/2012, 17:19

88 988 8
Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf

Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf

... deleting the data in the control Binding a DataGrid to a DataTable binds to the default view of the underlying DataTable The DataView class represents a view of the DataTable that can be data bound ... System.Data; using System.Data.SqlClient; private DataView dv; // private void ControlDataEditWithDataViewForm_Load(object sender, System.EventArgs e) { // Fill the Order table SqlDataAdapter da ... Forms and Web Forms The DataView can be customized for editing, filtering, searching, and sorting The DataView class can be used to add, edit, or delete records in the underlying DataTable The...

Ngày tải lên: 14/12/2013, 18:16

3 533 0
Tài liệu Global action plan to control the spread and impact of antimicrobial resistance in Neisseria gonorrho pdf

Tài liệu Global action plan to control the spread and impact of antimicrobial resistance in Neisseria gonorrho pdf

... Global action plan to control the spread and impact of antimicrobial resistance in Neisseria gonorrhoeae WHO Library Cataloguing-in-Publication Data Global action plan to control the spread and ... Sri Lanka Monica M Lahra, WHO Collaborating Centre for STD, South Eastern Area Laboratory Services (SEALS), Sydney, Australia Global action plan to control the spread and impact of antimicrobial ... can move towards attaining their national goals and targets 11 12 Global action plan to control the spread and impact of antimicrobial resistance in Neisseria gonorrhoeae Strategies for containing...

Ngày tải lên: 18/02/2014, 15:20

40 513 1
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

... scenario, the activation of growth factor receptors may in turn activate the Ras ⁄ Rac1 pathway, which has been shown to play a critical role in HSF1 activation and HSP up-regulation [14] We have reported ... [13] The overexpression of a desaturase gene in Saccharomyces cerevisiae, or the addition of exogenous fatty acids, can change the unsaturated ⁄ saturated fatty acid ratio and exert a significant ... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways,...

Ngày tải lên: 07/03/2014, 12:20

10 454 0
Money and happiness a guide to living the good life

Money and happiness a guide to living the good life

... 2002, meaning they lack the means to ensure themselves of healthy meals and are vulnerable to at least a mild form of chronic malnutrition.3 WEALTH AND VALUES I live in a home that has heat and running ... excited to read the Financial Times,” she says with a laugh When she was 14, her parents started a restaurant, and she began waitressing at night Her father encouraged her to save up for substantial ... So that weekend I went to Saks locally and told them that I was in New York, had bought all this makeup, came home, and my husband had a fit They took it all back That’s so me—there was no way...

Ngày tải lên: 12/03/2014, 14:51

258 363 0
A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx

A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx

... of the UNFCCC database and the NAPAs Like the latter, most cases are from sub-Saharan Africa, followed by South and Central Asia and Latin America, but in addition it shows that the vast majority ... Climate Change in Bangladesh The IFC clearly have the potential to play an important catalytic role in the objective of engaging the private sector in Climate Change Adaptation by both managing a ... interface which is a gateway to information on adaptation practices worldwide – the Local Coping Strategies Database It provides a summary of adaptation practices by a large range of organizations,...

Ngày tải lên: 16/03/2014, 14:21

49 559 0
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

Greener Events A guide to reducing the environmental impacts of conferences and seminars potx

... manager by the event manager Venue Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities Other facilities or amenities in the area and appropriateness ... seminars, where there is a specific need to gather many delegates and speakers together in one place, there are significant opportunities available for ensuring that environmental impacts are minimised ... also It is recommended that this guide is used to help select a suitable venue and to aid planning discussions with management and staff at the venue A copy should be passed to the venue manager...

Ngày tải lên: 16/03/2014, 19:20

5 532 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... negative  impacts,  especially  in  the future,  when  the province has the plan to develop the aquaculture  to be the key sector of local economics [6].   A re a (h e c ta r s ) January  and  ... The responsibility of the scientists is to screen  among these alternatives the feasible measures  based  on  applicability  and  suitability  for  the local conditions.   2.4. Evaluation criteria   After the problem and its constraints have  ... environment [3]. One of the disadvantages is  that  the relative  importance  of  evaluation  criteria is determined without considering the scales  on  which  the criteria  are  measured.  Another disadvantage is the large amount of ...

Ngày tải lên: 22/03/2014, 12:20

13 489 0
hacking vim a cookbook to get the most out of the latest vim editor

hacking vim a cookbook to get the most out of the latest vim editor

... Bhushan Pangaonkar Proofreader Chris Smith Nikhil Bangera Layouts and Illustrations Technical Editor Shantanu Zagade Ajay S Cover Designer Editorial Manager Dipali Chittar Shantanu Zagade About the ... such a way that the toolbar is just another menu with a special name Hence, adding an icon to the toolbar is just like adding an item to a menu In the case of a 'toolbar menu', you will be able to ... a clone of the Unix editor vi for the Amiga platform The first release of Vim for the Unix platform was out a year later and right away, it started to become an alternative to the vi editor The...

Ngày tải lên: 01/06/2014, 10:43

224 947 0
birdmen  the wright brothers glenn curtiss and the battle to control the skies   lawrence goldstone

birdmen the wright brothers glenn curtiss and the battle to control the skies lawrence goldstone

... tackle and pulleys Langley purchased a flat-bottomed houseboat on which to mount the apparatus and eventually send an aerodrome ranging down the Potomac All that was left was to get the most advanced ... feet The aim will be to eventually practice in a wind capable of sustaining the operator at a height equal to the top of the tower The pull of the rope will take the place of a motor in counteracting ... contacted the head of the local weather bureau and confirmed Kitty Hawk as the place to test his full-sized glider He then prepared the materials in Dayton, again alone, “cut, steamed, and bent the...

Ngày tải lên: 08/06/2014, 08:51

266 411 0
báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx

báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx

... and coordinated the study, participated in data cleaning and data analysis, and was the lead author on this paper ED performed data cleaning and data analysis SM contributed to data analysis, writing ... Tool, and UNITAID as provided by the Clinton Health Access Initiative [11-14] Antiretroviral transactional data was systematically cleaned and validated using a market intelligence database described ... obligations for India can increase ARV prices, impede the development of acceptable dosage forms, and delay access to newer and better ARVs Such measures can undermine the international goal to achieve...

Ngày tải lên: 20/06/2014, 08:20

9 283 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... (Table 2), and their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 1000 statements on people’s Riazi et al Health and Quality...

Ngày tải lên: 20/06/2014, 15:20

8 495 0
Báo cáo hóa học: " Binary Mixtures of SH- and CH3-Terminated Self-Assembled Monolayers to Control the Average Spacing Between Aligned Gold Nanoparticles" doc

Báo cáo hóa học: " Binary Mixtures of SH- and CH3-Terminated Self-Assembled Monolayers to Control the Average Spacing Between Aligned Gold Nanoparticles" doc

... gold via the [(CH3)3P]AuCH3 precursor onto the MPTS/OTS SAMs was carried out in a vacuum-sealed glass reactor chamber, which contained the samples and a small glass vessel with 20 mg of the Au precursor ... Nanofabrication Facility for the availability of FIB and SEM We also thank Todd Simpson and David R Tessier for their help Kim Baines from the Department of Chemistry is thanked for the availability ... in an increase in the average spacing between Au NPs Figures and show the Au NPs formed onto the refilled SAMs in the lines irradiated at the first two lowest doses (0.5 and 1.0 nC/cm) Each line...

Ngày tải lên: 22/06/2014, 00:20

5 227 0
Báo cáo khoa học: "An inactivated vaccine to control the current H9N2 low pathogenic avian influenza in Korea" docx

Báo cáo khoa học: "An inactivated vaccine to control the current H9N2 low pathogenic avian influenza in Korea" docx

... similar traits (Thr and Asn have a polar uncharged side chain, Val and Gly have a non-polar side chain, Glu and Asp are acidic amino acids) with the parent sequences However, the Thr133Asn change ... the evaluation of the inactivated AI vaccine efficacy Based on the animal challenge experiments (the experiments conducted in our lab and the data not presented), the Committee on the National ... For the SPF chickens, all of the viruses had a zero mortality rate; however, the viruses were isolated at to dpi from oropharyngeal swab samples, and to dpi from cloacal swab samples At dpi, the...

Ngày tải lên: 07/08/2014, 20:23

8 424 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

... breast ductal carcinoma: pathologic correlations and prognostic implications Hum Pathol 2001, 32(1):89-94 Sasano H, Frost AR, Saitoh R, Taniyama Y, Nagura H, Matsunaga G, Takehana K, Kimura M, ... expression was significantly associated with grade, lymph node spread, oestrogen receptor status and histological subtype for all invasive carcinomas These are factors that are also easily assessed ... prognostic value as there is a direct statistical association with the development of distant metastases in all invasive carcinomas, the subgroup of invasive ductal carcinomas and in the node negative...

Ngày tải lên: 09/08/2014, 01:24

9 424 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc

Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc

... organizations that are able to acquire, assess, adapt, and apply research and those that have fewer supports to so Further, the distinctions that the tool makes in relation to these four areas are ... been available Our observation from the focus groups was that the more useful aspect of the exercise was the discussion that took place as a result of the item on the tool, rather than the actual ... Research was not being adapted, however, on a regular basis In many cases, the roadblock was having a stakeholder partner accept the evidence Participants described how many factors played a role...

Ngày tải lên: 11/08/2014, 05:21

9 511 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf

báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf

... organizations that are able to acquire, assess, adapt, and apply research and those that have fewer supports to so Further, the distinctions that the tool makes in relation to these four areas are ... been available Our observation from the focus groups was that the more useful aspect of the exercise was the discussion that took place as a result of the item on the tool, rather than the actual ... Research was not being adapted, however, on a regular basis In many cases, the roadblock was having a stakeholder partner accept the evidence Participants described how many factors played a role...

Ngày tải lên: 11/08/2014, 16:20

9 417 0
w