abc a and a

ABC colour and write

ABC colour and write

Ngày tải lên: 01/01/2014, 17:46

50 1,4K 71
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG CTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: ... CACGAG-3¢;TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; ... death. Many researchers have investigated cell transplantation as an alternative treatment for heart disease. Bone marrow-derived mesenchymal stem cells (MSCs) are easily obtainable and expandable,...

Ngày tải lên: 18/02/2014, 04:20

11 653 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... 5¢-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3¢). The PCR product was purified, treated with T4 exonuclease to create vector-compatible overhangs and annealed to a prepared ... chitinolytic machineries, such as in the lactic acid bacterium (LAB) Lactococcus lactis ssp lactis IL1403. LABs are Gram-positive, facultatively, anaerobic, fermentative bacteria that are of major importance ... FEBS containing 100 lm of (GlcNAc) 1–4 was analysed at the start, in the middle and at the end of each series of sam- ples. The resulting average values of the standards (display- ing standard deviations...

Ngày tải lên: 18/02/2014, 08:20

14 684 0
Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf

Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf

... a disaccharide and a monosaccharide, and was thus identified as a mixture of Galb1-4[Fuca1-3]Glc- NAcb1-3Gal and Galb1-3[Fuca1-4]GlcNAcb1-3Gal. The calculated amounts of each oligosaccharide are ... b-hexosaminidase, giving rise to radioactive Gal, and identified as GlcNAcb1-3Gal. The trisaccharide was mostly sensitive to b1,4galactosidase, giving rise to a disaccharide and a monosaccharide, and ... to a trisaccharide that provides equal amounts of radioactive disaccharide and monosaccharide upon b1,3galactosidase treatment, and is thus identified as Galb1-3[Fuca1-4]GlcNAcb1-3Gal. The acid...

Ngày tải lên: 19/02/2014, 12:20

9 462 0
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

... 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c:5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP synthase subunit b:5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢- TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ ... 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢. Western blot Cells were rinsed in NaCl ⁄ P i , trypsinized and collected ... of PPARc coactivator 1a (PGC- 1a) signaling by an estrogen-related receptor a (ERRa) ligand. Proc Natl Acad Sci USA 101, 8912– 8917. 27 Lanvin O, Bianco S, Kersual N, Chalbos D & Vanacker JM...

Ngày tải lên: 06/03/2014, 09:22

13 506 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... Staphylococcus aureus Giulio Provenza 1, *, Maria Provenzano 1, *, Livia Visai 1,2 , Fiona M. Burke 3 , Joan A. Geoghegan 3 , Matteo Stravalaci 4 , Marco Gobbi 4 , Giuliano Mazzini 5 , Carla Renata Arciola 6 , ... FITC was measured in the FL1 channel (510–535 nm bandpass fil- ter). Data were recorded and analyzed with flowmax soft- ware from Partec. Statistical analysis of ELISA experiments Each experiment was ... - FnBPB-1 FnBPB-2/3 FnBPB-4 FnBPB-5 FnBPB-6 FnBPB-7 FnBPB-8 FnBPB-9 FnBPB-10 FnBPB-11 GST FnBRB FnBPB-1 FnBPB-2/3 FnBPB-4 FnBPB-5 FnBPB-6 FnBPB-7 FnBPB-8 FnBPB-9 FnBPB-10 FnBPB-11 GST FnBRA FnBPA-1 FnBPA-2 FnBPA-3 FnBPA-4 FnBPA-5 FnBPA-6 FnBPA-7 FnBPA-8 FnBPA-9 FnBPA-10 FnBPA-11 GST FnBRA A 490 nm AB CD 3.0 2.5 2.0 1.5 1.0 0.5 0.0 A 490 nm FnBPA-1 FnBPA-2 FnBPA-3 FnBPA-4 FnBPA-5 FnBPA-6 FnBPA-7 FnBPA-8 FnBPA-9 FnBPA-10 FnBPA-11 GST Fig....

Ngày tải lên: 06/03/2014, 22:21

16 569 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

... each domain caused the disappearance of a large set of NOESY cross-peaks and the parallel appearance of another set of cross-peaks, until a clean 2D spectrum belonging to a single species was ... form a distorted chair. The C-terminal a- domain is characterized by an adaman- tane-like four-metal cluster. Solution structures of 113 Cd-substituted Cd 7 MT-2 from rabbit, rat and human are available ... synthesis was from Rapp Polymere (Tu ¨ bingen, Germany), and all other chemicals were from Merck (Darmstadt, Germany). Synthesis of the individual a- and b- domains The individual a- and b-domains...

Ngày tải lên: 07/03/2014, 09:20

14 486 0
Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx

Báo cáo khoa học: Puroindoline-a and a1-purothionin form ion channels in giant liposomes but exert different toxic actions on murine cells pptx

... with the aid of a computer equipped with an analogue-to-digital interface board (DT 2821; Data Translation, Marlboro, MA, USA). Computerized data acquisition and analysis were performed with a program ... PTH-containing and PIN-containing crude fractions were dialyzed against de- ionized water and freeze-dried, and a1 -PTH, a2 -PTH and b-PTH were separated (at room temperature) by semipre- parative ... purified PIN -a and a1 -PTH A typical electrospray mass spectrum of purified wheat PIN -a (Fig. 1A) reveals that its apparent heterogeneity is related to complex post-translational proteolytic maturation...

Ngày tải lên: 07/03/2014, 12:20

13 437 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

... (3) and (4), the dissociation rate con- stant, k, and the O 2 affinity, K , can be derived for both the a and b subunits from the averaged parameters of HbA oxygenation (Table 1, Average). The association and ... Khan I, Juczszak L, Wang J, Manjula B, Acharya SA, Bonaventura C & Friedman JM (2004) Domain-specific effector interactions within the central cavity of human adult hemoglobin in solution and in ... in Figs 1 and 2. The transient absorption decays were analyzed using a standard least-squares technique using home- made software for PC. After kinetic normalization, analysis showed that the time...

Ngày tải lên: 16/03/2014, 14:20

11 578 0
Báo cáo khoa học: Crystal structures of the human SUMO-2 protein at 1.6 A and 1.2 A resolution ppt

Báo cáo khoa học: Crystal structures of the human SUMO-2 protein at 1.6 A and 1.2 A resolution ppt

... two primers 5¢-GGAATTCCATATGGGAGTCAAGACTGA GAA CAAC-3¢ and 5¢-CCGCTCGAGTCAACCTCCCGTCT G-3¢. The DNA products were checked on 1.5% agarose gels stained with e thidium bromide and t hen digested ... temperature, and coloured from red t o blue. Neutral a reas are shown in white. In (B) the conserved regions that interact with Ubc9 and Ulp1 are highlighted andcolouredinorange,cyanandmagenta,as in ... expression and regulation of protein activities are central to the cellular processes in an organism. Many proteins are rather short lived, and are eventually targeted to proteosomes f or degradation...

Ngày tải lên: 16/03/2014, 18:20

9 443 0
Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf

Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf

... cPLA 2 -a- medi- ated arachidonic acid release, and suggested that vimentin may function as an adapter protein for cPLA 2 -a at its site of localization. Several studies have also implied that cPLA 2 -a may ... plasma membrane, Golgi apparatus and nuclear envelope, was also used as a counter stain (Fig. 2). Once again, com- plete overlap was not seen, and only patches of colo- calization, particularly at the ... nuclear membrane and Golgi markers such as Con A, WGA and calreticulin. Thus it appears that cPLA 2 -a relocates to ER-like structures or microdomains of the ER and nuclear membrane. It may be...

Ngày tải lên: 16/03/2014, 18:20

13 388 0
The a and b adapters are used as priming sites for both amplification

The a and b adapters are used as priming sites for both amplification

... are added. Enzyme beads containing sulfurase and luciferase, and packing beads used only to keep the DNA beads in place. • Above the wells is a flow channel, passing nucleotides and apyrase ... broken, and the beads are released. • Enrichment beads are added (containing biotin); these attach to DNA rich beads only. • A magnetic field filters all DNA rich beads from empty beads, and ... DNA strand’s ends are made blunt with appropriate enzymes • A and “B” adapters are ligated to the blunt ends using DNA ligase • The strands are denatured using sodium hydroxide to release...

Ngày tải lên: 19/03/2014, 22:32

19 392 0
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

... Oxo-phytodienoic acid-containing galactolipids in Arabidopsis: jasmonate signaling dependence. Plant Physiol 145, 1658–1669. 47 Buseman CM, Tamura P, Sparks AA, Baughman EJ, Maatta S, Zhao J, Roth ... described in Materials and methods. EDE content was measured by UV absorbance of MGDG and DGDG fractions at 267 nm. Average values and standard deviations of five independent experiments are presented. Fig. ... maxi- mum at 267 nm with a smooth shaped spectral band. Fig. 1. RP-HPLC profiles of galactolipid molecular species from flax leaves. Total galactolipids were extracted from flax leaves, sepa- rated and...

Ngày tải lên: 23/03/2014, 05:22

10 388 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... the Hsp9 0a ORF using the forward primer AAATAA GTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC AT CTGCAGTTAGTCTACTTCTTCCAT (PstI site under- lined; ... YC, Kaplanek P, Tong A, Par- sons AB, Krogan N, Cagney G, Mai D, Greenblatt J et al. (2005) Navigating the chaperone network: an inte- grative map of physical and genetic interactions medi- ated...

Ngày tải lên: 23/03/2014, 07:20

11 428 0
w