a useful enzyme for modification of biopolymers

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

... Lipman et al., (1994), and were kindly provided by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' ... chosen that span introns of CD4 and CD8 genes in order to avoid amplification of cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional mutants are constructed ... as this was the largest number still within the linear range of the PCR (data not shown) In each assay we performed at least six different reactions for each sample using increasing amounts of...

Ngày tải lên: 11/08/2014, 08:20

4 321 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form part of genomic islands and have both pathogenicity and ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes...

Ngày tải lên: 07/03/2014, 12:20

11 574 0
Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx

Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx

... Herman JL: Trauma and Recovery: The Aftermath of Violence From Domestic Abuse to Political Terror New York, USA: Basic Books; 1997 Freyd JJ: Betrayal trauma: traumatic amnesia as an adaptive ... review of the medical record, as a summary of all staff accounts Although the nurses assigned both ratings after treatment, their judgment about pretreatment behavior was based on a summary of notes ... beginning of treatment (that is, from the subject's examination by a psychiatrist and formulation of a treatment plan by the clinical team) Research assistants ('raters'), who were master's level...

Ngày tải lên: 08/08/2014, 23:21

12 480 0
Báo cáo y học: " Pruritus: a useful sign for predicting the haemodynamic changes that occur following administration of vancomycin" ppsx

Báo cáo y học: " Pruritus: a useful sign for predicting the haemodynamic changes that occur following administration of vancomycin" ppsx

... radial artery cannula and pulmonary artery catheter [Arrow AH 050050-H, 7.5 F; Arrow International, Inc., Reading, PA, USA] transcutaneous oxygen saturation probe), vancomycin (15 mg/kg) was administered ... measure arterial and mixed venous blood parameters that are necessary for calculation of Qsp/Qt (i.e haemoglobin concentration, and oxygen tension and saturation) Analysis of the blood samples was ... collection of haemodynamic data, at each time point two blood samples were drawn (one from the radial artery cannula and another from the distal port of the pulmonary artery catheter) in order to measure...

Ngày tải lên: 12/08/2014, 18:21

6 261 0
a rapid method for estiminating of noise expouse workplace

a rapid method for estiminating of noise expouse workplace

... Golmohammadi R et al: A Rapid Method for Classification of workplaces based on noise pollution is one of the necessaries for macro programming view of monitoring and controlling of noise According ... noise aggravation, for each item a modified constant was considered Determining of these constants was based on best multiple regression analysis on SPSS package Total rank of noise pollution for ... or fiber board) Mean of noise sources life More than 10 years 5-9 years Less than years Quality of maintenance of equipments Suitable Little suitable Unsuitable Rotation and duration of noise produce...

Ngày tải lên: 05/09/2013, 13:23

7 419 0
Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes

Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes

... the case of a bill payable at the address of a 74 third party or in a locality other than that of the domicile of the drawee, or, except in the case of a bill drawn payable at a fixed period after ... the drawer may prohibit presentment for acceptance He may al so stipulate that presentment for acceptance 75 shall not take place before a named date Unless the drawer has prohibited acceptance, ... has a direct action on the bill of exchange against the acceptor for all that can be demanded in accordance with Articles 48 and 49 Article 29 Where the drawee who has put his acceptance on a...

Ngày tải lên: 22/10/2013, 10:15

38 674 0
A new algorithm for enumeration of minimum cutsets of graph by branch addition

A new algorithm for enumeration of minimum cutsets of graph by branch addition

... Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus ... Enumeration of Minimal Cutsets Separating Vertices in a Class of Undirected Planar Graphs," IEEE Trans on Reliability, Vol 41, No 1, March 1992 Li Yan, Hamdy A Taha, Thomas L Landers, "A Recursive ... figure and its minimum cutsets for output node are shown in Table The calculations have made by Matlab version 6.5 The cutsets of this graph have calculated in 0.8 second This algorithm also has applied...

Ngày tải lên: 03/01/2014, 19:35

6 547 0
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

... Meeting of the Association for Computational Linguistics, pages 188-195 Ferreira da Silva, J and G Pereira Lopes (1999) A local maxima method and a fair dispersion normalization for extracting ... relative rank of words in such a combined distribution provide a useful estimate of relative probability The availability of new techniques for handling large sets of n-gram data (e.g Gil & Dias ... untrue, and justifiable only as a simplifying idealization in the absence of a better model The actual probability of any sequence of words is strongly influenced by the base grammatical and semantic...

Ngày tải lên: 08/03/2014, 04:22

9 514 1
A new mechanism for modulation of schottky barrier heights on silicon nanowires

A new mechanism for modulation of schottky barrier heights on silicon nanowires

... drain and the silicon substrate as a back-gate, a transistor configuration can be defined as shown in Fig 5 (a) Transfer characteristics at different temperatures for a constant drain voltage of ... surface concentration taking this depth as a reasonable value for substantial tunneling This gives an energy lowering similar to the experimental data as given in Ref [10] Schottky barriers at nanowire ... The values in regime A are found in the range of 0.15 eV, while regime B has a sharp maximum at 0.55 eV and regime C again decreases the activation energy to about 0.25 eV All these values are...

Ngày tải lên: 16/03/2014, 15:14

5 401 0
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... with a Thermal Cycler DiceÔ Real Time System (TaKaRa Bio Inc.) The forward primer 5¢-CGGAACCAAAACATGC TAACATTTTC[FAM]G-3¢ (Invitrogen, Carlsbad, CA, USA) and the reverse primer 5¢-CGTTACAGGCAACTTGTTTCTCA-3¢ ... peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢...

Ngày tải lên: 30/03/2014, 04:20

12 350 0
Báo cáo khoa học: "A Joint Model for Discovery of Aspects in Utterances" potx

Báo cáo khoa học: "A Joint Model for Discovery of Aspects in Utterances" potx

... Domain Adaptation for Natural Language Processing at the the Annual Meeting of the Association of Computational Linguistics (ACL) 338 D Mimno, W Li, and A McCallum 2007 Mixtures of hierarchical ... assigns domain/dialog-act/slot labels to each topic at each layer in the hierarchy using labeled data (explained in §4.) We represent domain and dialog act components as meta-variables of utterances ... concept-attribute attachement Proc of the Annual Meeting of the Association of Computational Linguistics (ACL) J Reisinger and M Pasca 2011 Fine-grained class label markup of search queries In Proc of the Annual...

Ngày tải lên: 30/03/2014, 17:20

9 418 0
SAURASHTRA UNIVERSITY RAJKOT MASTER OF ARTS (ECONOMICS)CHOICE BASED CREDIT SYSTEM COURSE OF STUDIES SYLLABUS (A draft of CBCS courses in M.A., Economics submitted for Revision of Curriculum to be executed from ,June, 2010)ByDEPARTMENT OF ECONOMICS SA doc

SAURASHTRA UNIVERSITY RAJKOT MASTER OF ARTS (ECONOMICS)CHOICE BASED CREDIT SYSTEM COURSE OF STUDIES SYLLABUS (A draft of CBCS courses in M.A., Economics submitted for Revision of Curriculum to be executed from ,June, 2010)ByDEPARTMENT OF ECONOMICS SA doc

... have become very essential tools for data analysis, Information processing, modeling and graphical presentation The advancements for PC software and declining prices of hardware are the key factors ... factors, economic status, health, education, nutrition, caste, religion, race, rural-urban and status of husband and wife; Nuptiality Concept and analysis of marital status, single mean age at ... new classical approach - empirical evidence Approach of Mundell and other economists on open economy Asset Markets, Theory of Rational expectations - Monetary approach of balance of payment Basic...

Ngày tải lên: 31/03/2014, 03:20

120 454 0
the chemical laboratory its design and operation a practical guide for planners of industrial, medical, or educational facilities

the chemical laboratory its design and operation a practical guide for planners of industrial, medical, or educational facilities

... less often recognized as a problem In a food laboratory, for example, a six-unit Kjeldarl1 digestion and distillation apparatus was installed against a wall and the hot air was drawn off overhead ... Are areas for handling hazardous materials properly segregated? Are areas of potential hazards away from important traffic lanes? When all these questions are answered to the planner's satisfaction, ... stored away as retain samples by a cosmetics manufacturer will become a fIre hazard Medical and research laboratories have much the same storage requirements as industrial laboratories All need adequate...

Ngày tải lên: 31/05/2014, 01:37

173 562 0
báo cáo hóa học: " Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation" potx

báo cáo hóa học: " Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation" potx

... thank the Oklahoma Medical Research Imaging Core Facility for their assistance and Mrs Marilyn Bonham-Leyba for assistance with manuscript preparation References 10 Pramatarova A, Laganiere J, Roussel ... densitometry software (ImageQuant™, Molecular Dynamics) Within each sample, the density of each apoptosis-associated mRNA band was normalized to the sum of the L32 + GAPDH bands Eicosanoid assays PGE2 and ... were measured in cell culture medium using commercially available enzyme linked immunosorbent assays (ELISAs; Cayman Chemical, San Diego CA USA) Nitrite assay Cell culture medium was assayed for...

Ngày tải lên: 19/06/2014, 22:20

9 439 0
Báo cáo hóa học: " A general strategy for synthesis of metal oxide nanoparticles attached on carbon nanomaterials" pptx

Báo cáo hóa học: " A general strategy for synthesis of metal oxide nanoparticles attached on carbon nanomaterials" pptx

... article as: Zhao et al.: A general strategy for synthesis of metal oxide nanoparticles attached on carbon nanomaterials Nanoscale Research Letters 2011 6:71 Submit your manuscript to a journal ... new class of hybrid nanomaterials offers a great potential application in sustainable energy, environment, and even biomedicine Additional material Additional file 1: Supporting information Experimental ... HRTEM images revealed the detailed structures of these nanocrystals Typical HR-TEM image of Fe2O nanocrystals with diameters of approximately nm presents a crystal lattice of approximately 0.25...

Ngày tải lên: 21/06/2014, 06:20

5 356 1
báo cáo hóa học:" Research Article A Hypothesis Test for Equality of Bayesian Network Models" pptx

báo cáo hóa học:" Research Article A Hypothesis Test for Equality of Bayesian Network Models" pptx

... important to have reasonable guarantees that a maximum has been reached Thus, given the choice between an exact solution of a restricted class of models or an approximate solution of a general class ... Diabetes No pathways were detected at a FDR of 0.25 The two pathways with the smallest P-values were atrbrca Pathway and MAP00252 Alanine and aspartate metabolism (P = 0026, 003) In [33] the latter ... Dehmer, “Detecting pathological pathways of a complex disease by a comparitive analysis of networks,” in Analysis of Microarray Data: A Network-Based Approach, F Emmert-Streib and M Dehmer, Eds.,...

Ngày tải lên: 21/06/2014, 11:20

11 462 0
Báo cáo hóa học: " A Novel Route for Preparation of Hollow Carbon Nanospheres Without Introducing Template" ppt

Báo cáo hóa học: " A Novel Route for Preparation of Hollow Carbon Nanospheres Without Introducing Template" ppt

... realize polymerization and carbonization of alginate according to the theory of the rate of chemical reaction The filling ratio as an important parameter of hydrothermal systems has a critical ... may be explained why carbonization of alginate needed higher temperature than for carbonization of glucose Then nucleation of alginate took place when critical supersaturation of alginate was ... Fig 1a The broad peak indicates that the amorphism of product is because of poor crystallization As a kind of usual fashion, Raman spectroscopy is a powerful technique for characterizing the carbon...

Ngày tải lên: 22/06/2014, 00:20

6 350 0
Báo cáo hóa học: " Research Article A Stabilizing Algorithm for Clustering of Line Networks" pptx

Báo cáo hóa học: " Research Article A Stabilizing Algorithm for Clustering of Line Networks" pptx

... or a mobile agent, Mehmet Hakan Karaata clusterhead is a property of nodes such that this property can be transferred from a node to another and a node may possess at most one clusterhead Each ... aggregation and forward the data to the base station [23] In traditional networks, when a data object is accessed from multiple locations in a network, it is often advantageous to replicate the object and ... replicas throughout the network [24, 25] Potential benefits of data replication include increased availability of data, decreased access time, and decreased communications traffic cost As a result,...

Ngày tải lên: 22/06/2014, 06:20

10 298 0
w