... 3 matrix of parame-ters, such that pCa is a vector of probabilities at spacer position a, and pCabis the probability that the a-th spa-cer has length b In practice, to ensure that the prob-abilities ... could partially explain the improved performance of NESmapper over NoLogo at lower false positive rate Once again, analysis on a collection of yeast NESs that was not available to any of the methods ... class member-ship An example of an NES that is classified as having greater than 0.2 posterior probability in more than 1 con-figuration is that of the alpha-2 catalytic subunit of AMP-activated
Ngày tải lên: 25/11/2020, 15:13
... computational studies to evaluate the statistical significance of models such as phylogenetic trees [37] A bootstrap dataset has the same number of genes and conditions as the original data, but ... intensities of the particular module and transcription factors, we have plotted the T-statistics of the b’s rather than their actual values Statistically significant values are marked by dotted ... of the gene expression in each module Both approaches are guided by the principle of Occam’s razor, that is, that the simplest model explaining the data is the best, and both approaches, as we
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: " A reaction-diffusion model of the receptor-toxinantibody interaction" pot
... variety of possible scenarios of the evolution of the RTA system and provide a reasonable estimate of timescales of the associated d ynamics. The consistent match of the numerical predictions with the ... a study would include an application of a data fitting algorithm that accounts for the experimental data uncertainty as well as some additional assumptions about relationships of the ... of the values of para- meters for the mo del (1)-(4) was motivat ed by the values available in the literature [11,19-22] with the extended range to allow exploration and illustration of the various
Ngày tải lên: 13/08/2014, 16:20
cheap talk, valuable results- a causal attribution model of the impact of promises and apologies on short-term trust recovery
... literature on social accounts, it is argued that these forms of cheap talk are negatively related to the victim’s attributions of stability regarding the cause of the violation Lower stability attributions ... and indicates that a violation leads to a state of instability, negative affect, and uncertainty The psychological states prompted by the trust violation result in (1) a cognitive appraisal of ... appraisal of the discrepancy, and (2) a distressed emotional state The cognitive appraisal refers to the victim’s assignment of culpability to the offender and the evaluation of the costs associated
Ngày tải lên: 02/11/2014, 00:26
A Predictive Structural Model of the Primate Connectome
... originating in 11 of the 29 injected areas and targeting all 91 areas of the M132 atlas Specifically, NSG% was computed as the number of supragranular labeled neurons divided by the sum of supra-granular ... Thickness model: Cortical thickness Cortical thickness data were extracted from an anatomical T1-weighted magnetic resonance (MR) brain scan of one male adult macaque monkey (Macaca mulatta) Animals ... densities in the macaque cortex depicted on the M132 parcellation 38 Gray areas: no density data available Abbreviations as in ref 38 Trang 3connected areas, as also shown by a rank correlation coefficient,
Ngày tải lên: 19/11/2022, 11:45
a model of the impact of mission statements on firm performance
... Company performance Abstract A relationship between mission and organizational performance was modeled by drawing on previous research. The model was tested with data from 83 large Canadian and ... financial measures on the basis of those to which analysts and managers pay the most attention (Venkatraman, 1989). They are also among the ones most frequently used in academic assessments of performance ... Many details, however, are still lacking. In particular, a clear understanding of the balance between critical mission variables, their interaction with one another and their overall relationship
Ngày tải lên: 07/07/2014, 10:38
Báo cáo y học: "Molecular model of the outward facing state of the human P-glycoprotein (ABCB1), and comparison to a model of the human MRP5 (ABCC5)" docx
... ABCC7 ABCC4 ABCC3 ABCC1 ABCC2 ABCC6 ABCC9 ABCC8 ABCC10 ABCA7 ABCA1 ABCA4 ABCA2 ABCA3 ABCA13 ABCA12 ABCA10 ABCA9 ABCA6 ABCA5 ABCG4 ABCG1 ABCG2 ABCG8 ABCG5 ABCD2 ABCD1 ABCD3 ABCD4 Trang 5cation ... branches are seen, with ABCB, ABCC and ABCD in one branch, and ABCA and ABCG in the other branch ABCB and ABCC subfamilies are closer related to each other than to the ABCD subfamily Sav1866 is situated ... Sav1866-TMD and the ABCB1- and ABCC5-TMDs thus indicate that they have an overall similar organization and that the Sav1866-TMD may have been a suitable template for modeling the TMD segments of ABCB1 and
Ngày tải lên: 13/08/2014, 16:21
Báo cáo y học: "A mathematical model of the euglycemic hyperinsulinemic clamp" ppsx
... modeling, statistical analysis, drafting of the manuscript; ADG: mathematical modeling, drafting of the manuscript; SP: mathematical modeling; SD: mathematical modeling; GM: design of the experiment, ... Tgx(t) and Tix(t) are (input or forcing) state variables of which the values are known at each time; the state varia-bles and the parameters are defined in tavaria-bles 2 and 3 The model is diagrammatically ... uptake rates at two hours are nonlinearly related to increasing lev-els of plasma insulin, and from the reported data, glucose uptake may approach a maximal value asymptotically as insulinemia
Ngày tải lên: 13/08/2014, 23:20
engle and lange-predicting vnet - a model of the dynamics of market depth
... traded, the actual amount prices moved, theelapsed clock time (PTIME), and the bid}ask spread are the fundamentalstatistics; average trade size and the average time between trades, as well asinteraction ... presence of informed traders in themarket tends to amplify the price impact of a trade These models assume that Trang 6there is some probability of a private news event that is revealed to a subset ofthe ... assessment A number of studies have looked at this identi"ca-tion issue from a stationary point of view using both the bid}ask spread and theprice impact of a trade Easley and O'Hara (1987) and Hasbrouck
Ngày tải lên: 31/10/2014, 12:07
three extensions to the inventory theoretic approach- a transportation selection model, a discrete event simulation of the inventory theoretic approach, postponement from an inventory theoretic perspective
... problematic (the matrix approach) Conversely, optimization models can handle a wide variety of variables, easily accommodate additional constraints, and guarantee the optimal answer given valid assumptions ... addition, they efficiently handle a wide variety of variables, constraints are easily added or changed, and they guarantee the optimal answer given valid assumptions and accurate data Hence, additional ... gives their model a great deal of flexibility They found that the optimal choice of transportation requires a trade-off among the cost of transportation and the cost of inventory Transportation
Ngày tải lên: 02/11/2014, 00:50
a one-dimensional model of blood flow in arteries with friction, convection and unsteady taylor diffusion based on the womersley velocity profile
... is a change in the waveform of the arterial pulse: the disappearance of a secondary peak known as the dicrotic wave [20, 37] This was discovered by Henry Lax nearly 50 years ago Accurate simulation ... thus maintaining a more nearly steady flow than would other- wise be the case The total cross-sectional area of the aorta is about 2.5 cm?, which then branches out to a total of approximately ... Trang 22an artery in the tree These profiles respond to changes in the characteristics of the arterial tree, such as arterial wall compliance, in a way that distinguishes normal and abnormal
Ngày tải lên: 13/11/2014, 10:12
a translation quality assessment of the first three chapters of the novel the da vinci code by do thu ha (2005) based on j.house's model = đánh giá chất lượng bản dịch ba chương đầu tiên trong cuốn tiểu thuyết
... cases of ungrammaticality (clear breaches of the target language system) and cases of dubious acceptability (breaches of the norm of usage) Trang 17non-Mistakes in the denotative meanings of ST and ... semantic translation and communicative translation They are put in the form of a flattened V diagram as below: Literal translation Free translation Faithful translation Idiomatic translation ... - Qualitative method: This research is a qualitative evaluation; hence, the source of data is document, and information is gathered by an analysis of documents and materials Data are categorized
Ngày tải lên: 02/03/2015, 14:22
A translation quality assessment of the first three chapters of the novel “the da vinci code” by do thu ha (2005) based on j.house’s model
... individual text closely It also enables multiple analytic strategies - Synthetic and analytic methods: The analysis of the texts is also approached from the combination of analytic and synthetic ... terms of breaches of the target language system, the TT shows several cases of ungrammaticality as can be seen as follows: mistake Suggested alternative 1 ―The frightening image of the curator's ... clear than that of the ST and breaching the consultative and casual style level of the ST For example: ST TT Suggested alternative 1 ―The room was spartan – hardwood floors, a pine dresser, a
Ngày tải lên: 10/08/2015, 19:48
A statistical model for the transmission on infectious diseases
... real data Although the mathematical models are elegant, there are still some reasons that more practical statistical models should be developed During the outbreak of an infectious. .. and ... Although the mathematical models are elegant, there are still some reasons that more practical statistical models should be developed. During the outbreak of an infectious disease, what we can observe ... stochastic models, illustrates the use of a variety of the models using real outbreak data and provides us with a complete bibliography of the area The book that has received most attention
Ngày tải lên: 26/09/2015, 09:57
The effects of blended instruction on oral reading performance and their relationships to a five-factor model of personality
... Yoshikawa, Kibi Chuo-Cho, Kaga-Gun, Okayama Prefecture, 716-1241 Japan E-mail: noritake_fujishiro@pref.okayama.lg.jp Isao Miyaji Faculty of Informatics, Okayama University of Science, Japan 1-1 ... using a digital video recorder before and after the lessons In the Experiment 1, two raters, an ALT (Assistant Language Teacher) who was a native speaker of English and a JTE (Japanese Teacher of ... „Conversation Practice‟, „Expressing Ideas‟, and „Let‟s Talk‟ As for characteristics, the WBT courseware has a large quantity of video and sound clips as conversation models and learners can easily
Ngày tải lên: 10/01/2020, 08:07
Sampling the folding transition state ensemble in a tube-like model of protein
... hEi, the mean radius of gyration hRgi, and the specific heat for protein 3HB and protein GB1 Both the average energy and the mean radius of gyration show a sharp change near a temperature, at which ... gyration, and the specific heat The latter is defined asC=hE 2i − hEi2 The folding temperature Tf is defined as the temperature of the maximum of the specific heat The radius of gyration of a ... also broad with a large variety of conformations The examples of conformations shown in Fig 7b indicate that the transition state may arise with the formation of a portion of the β -sheet or a piece
Ngày tải lên: 13/01/2020, 14:06
A model of the supplier involvement in the product innovation
... out the analytical solutions to the nonlinear differential system constituted by equations (10) and (11), so we have to make the local stability analysis near the steady state characterized by the ... infeasible Only when the effort level at point G is selected on the converging path aa’ , can the supplier arrive at the feasible and sustainable steady state at the point E If the initial product ... case study of an auto manufacturer Proactive role of the supplier, role of auto manufacturer as coordinator, linkage between production and development, supplier’s support to other auto manufacturers
Ngày tải lên: 03/02/2020, 21:08
A translation quality assessment of the vietnamese version of chapter 6 in the novel lady chatterleys lover using j houses model
... is to have the translation „proof-read by native speakers of the target language‟ A translation must satisfy readers as native speakers of the target language It means that they are able to interpret ... translation with the original 4 An evaluation of the translation: in the translation‟s terms and in the critic‟s terms 5 An assessment of the likely place of the translation in the target language ... read as if heard because when reading the text, readers are aware of the fact that they are listener and the narrator acts as story-teller, witnessing what is happening The medium is characterized
Ngày tải lên: 09/03/2020, 18:45
Integrated analysis of the proteome and transcriptome in a MCAO mouse model revealed the molecular landscape during stroke progression
... GGAGCGAGATCCCTCCAAAAT R: GGCTGTTGTCATACTTCTCATGG F: TCCAACAAGAACACCCTCA R: GGCTGGATAAGTCCCACA F: CACCTGAAGCCCTATGCC R: CTCCTTGATCGTGGTCTGC F: ATGGTGGAAGCACAGTTG R: TGGTTTGTGTCCAGGTCC C3 APOA4 S100A9 ... urea Then, lL of 0.5 M TCEP was added, and the sample was incubated at 37 for h Next, lL of M iodoacetamide was added to the sample, and it was incubated for 40 in the dark at room temperature ... significantly differentially expressed proteins To obtain an overview of the characteristics of DEPs, the R package was used to generate a Venn diagram and heatmaps, and hierarchical clustering analysis
Ngày tải lên: 11/05/2020, 10:41
Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc
... with KALEIDAGRAPH (Abelbeck Software, Reading, PA, USA). A series of constant or changing values were generated for the different input variables and the calculations were done using the appropriate ... mRNA accumulation in transgenic Arabi- dopsis thaliana. Plant Cell Physiol. 42, 1174–1180. 46. Hacham, Y., Avraham, T. & Amir, R. (2002) The N-terminal region of Arabidopsis cystathionine gamma-synthase ... Phser branch-point in the aspartate-derived amino acid biosyn- thetic pathway in plants. In plants and microorganisms, aspartate serves as a precursor for the synthesis of lysine, methionine and...
Ngày tải lên: 20/02/2014, 02:21
Bạn có muốn tìm thêm với từ khóa: