a toolbox for spatial analysis on a network

... load of thin-walled composite beams Navier solution is used by [11] for buckling and free vibration analysis of thin-walled composite beams Shan and Qiao [12] conducted a combined analytical and ... plane strain state for beams with arbitrary angle Available litera-tures indicate that plane stress assumption is more appropriate and widely used for composite beams [23,24,28–30] Figs.3(a)–3(f)show ... used FEM for flexural-torsional stability analysis of thin-walled composite beams In recent years, buckling be-haviours of thin-walled functionally grade open section beams are also analysed [18–21]

Ngày tải lên: 13/01/2020, 13:41

... data for ocsESTdb: logical relationships among sequence data, annotation information, pathways and networks are con-structed based on unigenes assembled with clean raw ESTs Second is to prepare ... Trang 1D A T A B A S E Open AccessocsESTdb: a database of oil crop seed EST sequences for comparative analysis and investigation of a global metabolic network and oil accumulation metabolism Tao ... ocsESTdb: a Web-based, searchable and downloadable database is con-structed to provide a high-level data resource on processed sequence information, functional annotation and biological meaning assigned

Ngày tải lên: 26/05/2020, 23:33

... that forHAL in conventional analysis In network meta-analysis, the OR was 0.48, which was similar to that in conventional meta-analysis; however, the 95 % CI was lon-ger than that in conventional ... meta-analysis The lonlon-ger 95 % CI for the network meta-analysis was calculated by indirect comparison based on Bayesian networking A meta-analysis compared photosensitizing agents (5-ALA in ... randomized controlled trial, NA not applicable, 5-ALA 5-aminolaevulinic acid, HAL hexylaminolevulinate, NBI narrow band imaging a Quality assessment was based on Cochrane’s risk of bias as a

Ngày tải lên: 28/09/2020, 01:25

... expression analysis, as Table Individual results on simulation data miRNA probe A5 scores p-value Classification VIMP using error rate random forests miRNA-alternative 0.01774 0.44653 0.00275 miRNA-alternative ... keeps a statistically good distribution and also a clear category distinction, has the highest A5 score, the minimal pvalue and the smallest average of classification error rate As to the variable ... variable pair miRNA-alternative and miRNA-alternative which keeps a statistically good distribution but an inferior category distinction, a smaller p-value and a bigger average of classification error

Ngày tải lên: 25/11/2020, 12:29

... operating ability, robots are capable of working in hazardous environments In addition, the robot can perform tasks with heavy loads and toxic substances and can adapt to particular environmental ... overall system and system coordinates The global coordinate is chosen as in Figure 2.1 (b) System states are rotational angular about Ox, Oy, Oz axes, and translational position along the vertical ... based on the advantages of parallel structure, namely low inertia moment, high load, and smooth transmission capacity [6] From reality-based car models, to assist trainees and drivers have an alternative

Ngày tải lên: 20/07/2022, 07:48

... approximately? What is a suitable model for input data distribution to talk about generalization? Consider the capacity question: While neural networks are known to have many universal approxi-mation results ... models against a non-neural network based approach For this, we use KaMIS as our solver for each cell, and call the resulting framework K-Baker In Table 2, we show the average time taken to solve a ... connection to distributed local algorithms also leads to negative results: roughly speaking, these constant factor approximations for the special family of constant-degree graphs are the best that a

Ngày tải lên: 28/10/2022, 02:53

... of online databases dealing with genomes, enzymatic pathways, and biological chemicals A total of 92 genes appear on the rheumatoid arthritis pathway in the KEGG database These genes are considered ... considered to be associated with RA Based on the above three databases, we obtained 163 distinct genes that are associated with RA (see Table S1 in Supplementary Material available online athttp://dx.doi.org/ ... bone formation The osteoclast differentiation pathway is a biological process that maintains bone density and structure through a balance of bone resorption by Trang 6IFN 𝛾 RANKL Synovium Bone

Ngày tải lên: 02/11/2022, 08:46

... Trang 1A conceptual framework for the analysis of the effect of institutions onbiofuel supply chains J.A Moncadaa,b,⇑, Z Lukszoa, M Jungingerb, A Faaijc, M Weijnena
Proposes a conceptual framework ... place in the actionarena and they are repeated until the stop criteria (final year)are met Agents adapt to the environment in each iteration Theadaptation mechanism is incorporated into ‘‘forecasting ... consideraassump-tions Nuñez et al.[19] devel-oped a mathematical model to analyze the impacts of biofuel mandates and trade distortions on land use, agricultural and trans-portation fuel markets,

Ngày tải lên: 08/11/2022, 14:57

... felt satisfied with the machine system CONCLUSION AND RECOMMENDATIONSConclusionAs far as analyzed above, the job satisfaction at the IBT has been deeply concerned For all of the research questions ... reproduction.Study on generation of the genetically modification (GMO) animals and their cloning.An analysis on job satisfaction at the IBT from its staff’s perspectiveThe sampling frame consisted ... the salary levels will be higher.QUESTIONNAIRE ON THE JOB SATISFACTION AMONG THE IBT’SAPPENDIX 1: QUESTIONNAIRE ON THE JOB SATISFACTION AMONG THE IBT’S EXISTING AND I am a senior of Hanoi Foreign

Ngày tải lên: 02/10/2023, 06:41

... international expansion of Asian apparel brands is one noticeableindustry trend One of the leading Asian brands, Uniqlo from Japan, is the case Withmore than 800 retail locations in Japan alone, ... retailers) Argentina (compared to Zara) Marketing capability High market capability worldwide Prices & conditions More attractive than ZaraExpensive (compared to locals) More attractive than Zara ... Vin Fast Goes Global - Of cial Cas… InternationalMarketing 100% (2) 7 Investigative Marketing Report OF… InternationalMarketing 100% (1) 13 International Marketing - EXAM… InternationalMarketing

Ngày tải lên: 30/01/2024, 05:34

... state estimation plays a vital role in controller calculation or simply collecting information for visualization and monitoring, Tn addition, system signals, including position and velocity, apparently ... Design an adaptive controller and a state observer based on neural network for the 4DOF parallel robot NGUYEN MANII CUONG Control Engineering and Automation Supervisor: Assoc Prof Nguyen Tung Lam ... with the Quadrolor drone [$2], the high-gain nonlinear observer was used ta monitor, analyze, and compensate for the actuatar’s deviation and the measurement errors In addition, the controller

Ngày tải lên: 10/06/2025, 11:54

... working in hazardous environments In addition, the robot can perform tasks with heavy loads and toxic substances and can adapt to particular environmental conditions Thus, these advantages have signifieanily ... working in hazardous environments In addition, the robot can perform tasks with heavy loads and toxic substances and can adapt to particular environmental conditions Thus, these advantages have signifieanily ... robot can perform tasks with heavy loads and toxic substances and can adapt to particular environmental conditions Thus, these advantages have signifieanily contributed to produclivity and qualily

Ngày tải lên: 21/06/2025, 02:49

... (mean and standard deviation) This point is rarely raised in literature: analysis and Monte Carlo simulations can lead to quite different outage probabilities even if analytical average and variance ... for the traditional hexagonal network The simplicity of the result allows a spatial integration of the OCIF leading to closed-form formula for the global outage probability and for the spatial ... Conclusion In this paper, we have proposed and validated by Monte Carlo simulations a fluid model for the estimation of outage and spatial outage probabilities in cellular networks This approach...

Ngày tải lên: 21/06/2014, 11:20

... Krystyna Szyku a, Axente Stoica, Dan Savastru, Marina Tautan, Carla Bernadete Madureira Cruz, Rafael Silva de Barros, Janvier Fotsing, Emmanuel Tonye, Bernard Essimbi Zobo, Narcisse Talla Tankam, ... Chapter Chapter Web Map Tile Services for Spatial Data Infrastructures: Management and Optimization Ricardo Garc a, Juan Pablo de Castro, Elena Verdú, Mar a Jesús Verdú and Luisa Mar a Regueras ... Mathematical Analysis in Cartography by Means of Computer Algebra System Shao-Feng Bian and Hou-Pu Li Chapter Web Map Tile Services for Spatial Data Infrastructures: Management and Optimization...

Ngày tải lên: 28/06/2014, 10:20

... policy Example: Monitoring HIPAA applications for unauthorized activity Title II of HIPAA addresses security and privacy of health data Among many other safeguards, it states that “Information systems ... United States or Canada) 707-829-0515 (international or local) 707-829-0104 (fax) We have a web page for this book, where we list errata, examples, and any additional information You can access ... create a watermark against the traffic that will be measured Sustained statistical deviations above or below that watermark are triggers for the tool to analyze the traffic further and produce an...

Ngày tải lên: 22/03/2014, 21:20

... investigations on the current European research landscape for AAL and again prove a certain lack of international consolidation To give a common example, certain expressions which http://www.aal-europe.eu/contacts, ... individual’s hearing ability It also makes available different information about equipment already on the market and gives general information for example to family members Via an ePlatform, these ... primarily a data collection task force The project developed a “multidisciplinary and cross-national panel database of micro data on health, socio-economic status and social and family networks...

Ngày tải lên: 28/03/2014, 16:20

... Image Analysis Algorithms Image analysis consists of extracting some relevant parameters from one or several images Image analysis examples are object segmentation, feature extraction, motion ... This architecture is designed for most of image analysis applications Characteristics from such applications are used to propose a parameterized and adaptable architecture for FPGA 2.1 Characteristics ... easier than with Design Compiler Conclusion and Perspectives The presented architecture is a parameterized architecture dedicated to image analysis applications on FPGA All flows and data are analyzed...

Ngày tải lên: 21/06/2014, 20:20

... subsystems for the sample preparation for the electronic hybridization detection and the data analysis The sample preparation subsystems in case of DNA analysis concerns DNA extraction, PCR, and hybridization ... array Standard deviation calculation for one muta6600 microseconds tion (μBlaze at 100 MHz) Standard deviation calculation for the entire array (μBlaze at 100 MHz, calculating 850 5600 milliseconds ... Standard deviation calculation for one muta0.36 microseconds tion (using a HW core-accelerator) Standard deviation calculation for the entire 3.06 milliseconds array (using a HW core-accelerator)...

Ngày tải lên: 21/06/2014, 22:20

... Classification Baseband reconfigurable processing (a) Received signal RF stage ADC TF Analysis Features extraction Classification Baseband reconfigurable processing Mode identification (b) Figure 1: A general ... SP tools that can be employed for analysis of nonstationary signals and in other different applications [19] In this case, TF allows one to use a compact and robust signal representation By using ... superposition In an SR scenario, some signals can be strongly nonstationary and Time-Frequency Analysis for Mode Identification Received signal Transduce 1781 Features extraction Preprocessing Classification...

Ngày tải lên: 23/06/2014, 01:20

... ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... to APAF and hence activates CASP9 leading to the caspase cascade resulting in apoptosis G2 arrest and DNA damage signaling could also activate BAX leading to mitochondria-mediated apoptosis On ... pathway were MAP2K3 (MEK3) located along the MAPK p38 cascade and NFKBIA associated with NFKB activation (Figure 6, Additional File 2), indicating the upregulation of p38 pathway In JNK MAPK and...

Ngày tải lên: 13/08/2014, 01:20