a tool for mathematicalrelativity and vice versa

Geosite and Geomorphosite Assessment as a Tool for Geoconservation and Geotourism Purposes: a Case Study from Vizovická vrchovina Highland (Eastern Part of the Czech Republic)

Geosite and Geomorphosite Assessment as a Tool for Geoconservation and Geotourism Purposes: a Case Study from Vizovická vrchovina Highland (Eastern Part of the Czech Republic)

... Western Carpathians The area is a part of Magura Flysch Belt (Rača tectonic unit) that is formed of alternating layers of claystones and sandstones of Mesozoic and Paleogene age The area is characterised ... criteria for establishing national geoparks as well as criteria for the temporary status of candidate geopark Today, there are six rytířů and Podbeskydí The candidate geoparks are Vysočina, Ralsko, ... Significant Landscape Component; the landforms and landscapes of larger scale are protected in the category of Natural Parks In these sites and areas special conditions apply in relation to the water

Ngày tải lên: 30/12/2018, 14:47

11 176 0
ClustAGE: A tool for clustering and distribution analysis of bacterial accessory genomic elements

ClustAGE: A tool for clustering and distribution analysis of bacterial accessory genomic elements

... This analysis showed that the accessory genomes of strains 19BR and 213BR were nearly identical It also a b Fig 5 Genomic island variability a Alignment of P aeruginosa genomic islands PAGI-5, PAPI-1, ... between strains With the increase in availability and affordability of whole-genome sequencing, large-scale genomic analyses of populations of isolates have become more feasible Software packages, ... the added read alignment data and a separate set of “read-corrected” subelement sequence and coordinate files are output If optional plotting of AGE distributions was chosen, read-aligned AGE

Ngày tải lên: 25/11/2020, 15:43

12 19 0
TechnoGIN, a tool for exploring and evaluating resource use efficiency of cropping systems in east and southeast asia

TechnoGIN, a tool for exploring and evaluating resource use efficiency of cropping systems in east and southeast asia

... buttons and forms required for database management and output analysis The buttons anduser-forms give access to data stored in the database file and allow rapid selectionuser-of specific combinations ... (Van Ittersum and Rabbinge, land-1997) In TechnoGIN, most inputs and outputs are calculated on a cropping seasonand an annual basis Exceptions are labour and water requirements, which are Trang ... system can also be applied if part of the data (e.g.,water and/or biocide use) are not (yet) available A Quickstart manual is availablefor more information on minimum data requirements for TechnoGIN

Ngày tải lên: 18/10/2022, 18:27

21 4 0
Using maps and models as a tool for conservation and management in the age of the anthropocene pieces of evidence from indigenous protists and a local landscape of the philippine archipelago

Using maps and models as a tool for conservation and management in the age of the anthropocene pieces of evidence from indigenous protists and a local landscape of the philippine archipelago

... mask and extract Landsat images for each dataset using the "Extract by Mask" tool in ArcToolbox.ArcMap 10.8 software was utilized to create the study area map essential for classification Finally, ... significant land-use and land-cover (LULC) changes due to rapid and uncontrolled population growth alongside industrialization.Land Use and Land Cover (LULC) change plays a crucial role across various ... dataset The classification output was then assessed for accuracy by comparing the classes with Landsat data Following the evaluation and validation of the classification results, the data was

Ngày tải lên: 13/06/2023, 16:05

78 2 0
Using maps and models as a tool for conservation and management in the age of the anthropocene pieces of evidence from indigenous protists and a local landscape of the philippine archipelago

Using maps and models as a tool for conservation and management in the age of the anthropocene pieces of evidence from indigenous protists and a local landscape of the philippine archipelago

... Union for Conservation of NatureLas Piñas – Parañaque Critical Habitat and Ecotourism AreaLand Use Land Cover Mindoro, Marinduque, Romblon, PalawanOperational Land Imager Regularization MultiplierReceiver ... iswidespread and has been observed in a wide variety of habitats, including temperateforests (Kazunari, 2010; Takahashi & Hada, 2009), tropical rainforests (Dagamac, 2012),dry land ecosystems, and ... 1973).dark-2.3 Land use/ Land cover classification using remote sensing and its application to coastline studies Several types of thematic data crucial to GIS analysis, such as data on land use andland cover

Ngày tải lên: 23/06/2023, 09:07

80 2 0
FluSHELL – A Tool for Thermal Modelling and Simulation of Windings for Large Shell-Type Power Transformers ( TQL )

FluSHELL – A Tool for Thermal Modelling and Simulation of Windings for Large Shell-Type Power Transformers ( TQL )

... revealsequivalent degrees of accuracy and detail FluSHELL shows average accuracies of 1.8 °Cand 2.4 °C for the average and maximum temperatures, respectively, and the locations with average deviations ... by magnetic induction, transforms a system of alternating voltage and current intoanother system of alternating voltage and current usually of different values and at other words, each transformer ... Trang 16List of Figuresglued over it: a photograph b schematic representation and turns of each coil: a before assembling and b after assembling transformer: a perpendicular magnetic shunts and

Ngày tải lên: 27/04/2020, 09:11

214 84 0
Non-targeted metabolite profiling of citrus juices as a tool for variety discrimination and metabolite flow analysis

Non-targeted metabolite profiling of citrus juices as a tool for variety discrimination and metabolite flow analysis

... retention time) and peak area values per sample was obtained Statistical analyses Hierarchical Cluster Analysis (HCA) was performed with pvclust package running under R 3.2 and PLS-DA was performed using ... + Annotation level: 1) co-injected with pure standards, 2) annotated matching published data and mass spectral results and 3) annotation made based on mass spectral data, *) tentatively annotated ... literature and co-injection with pure standards when available All stan-dards were purchased from Sigma-Aldrich (Madrid, Spain) except for ABA and derivatives that were ob-tained from the Plant

Ngày tải lên: 26/05/2020, 23:46

16 20 0
CAMSA: A tool for comparative analysis and merging of scaffold assemblies

CAMSA: A tool for comparative analysis and merging of scaffold assemblies

... edges), and their scaffold assembly graph SAG(A1, A2, A3) Scaffold edges are colored black Actual assembly edges are shown as solid, while candidate assembly edges are shown as dashed a Individual ... Individual scaffold assembly graph SAG(A1) b Individual scaffold assembly graph SAG(A2) c Individual scaffold assembly graph SAG(A3) d Scaffold assembly graph SAG(A1, A2, A3) the identically labeled ... Trang 1R E S E A R C H Open AccessCAMSA: a tool for comparative analysis and merging of scaffold assemblies Sergey S Aganezov1,2*and Max A Alekseyev3 From 6th IEEE International Conference

Ngày tải lên: 25/11/2020, 16:27

10 28 0
A tool for efficient fertilizer and water management

A tool for efficient fertilizer and water management

... Trang 1A TTrang 2A Tool for Efficient Fertilizer and Water ManagementU Kafkafi and J Tarchitzky International Fertilizer Industry Association (IFA) International Potash Institute (IPI) Paris, ... extension agents and consultants on water quality, soil and water salinity, wastewater use for crop irrigation, agricultural and municipal solid wastes usage for crop nutrition and soil amendments ... implies that larger wet surface areas are exposed to direct water evaporation and to a gradual built up of salt accumulation at the soil surface Repeated frequent irrigation and evaporation cycles,

Ngày tải lên: 28/01/2021, 07:56

141 24 0
using facebook as a tool in teaching and reviewing  english idiomatic expressions for grade 12th students

using facebook as a tool in teaching and reviewing english idiomatic expressions for grade 12th students

... expressions are a part of every language'svocabulary and are based on that language history, heritage, and culture.Learning idiomatic expressions helps non-native speakers of a language becomemore ... buckets/pails One cannot turn cats and dogs in It was raining cats and dogs into the singular, either: *It was raining a cat and a dog). ● The Use of Actives/Passives Normally a transitive verb phrase ... this research consists of threeparts: - Theoretical and practical background - Introducing and reviewing idioms via Facebook - Results and evaluation PART 2: THEORETICAL AND PRACTICAL BACKGROUND

Ngày tải lên: 21/05/2021, 22:12

67 19 0
Image and fractal analysis as a tool for evaluating salinity growth response between two salicornia europaea populations

Image and fractal analysis as a tool for evaluating salinity growth response between two salicornia europaea populations

... Trang 1R E S E A R C H A R T I C L E Open AccessImage and fractal analysis as a tool for evaluating salinity growth response between two Salicornia europaea populations S Cárdenas-Pérez1*, A ... ΔE), arranged in a matrix with the average values obtained from replicates of each treat-ment and population A two-way ANOVA comparing treatments within populations and populations within treatments ... ml Acetone mg sample ð4Þ DNA extraction and RAPD analysis A complementary genetic analysis was developed as part of an initial attempt to identify the genetic vari-ation patterns among S europaea

Ngày tải lên: 28/06/2021, 20:55

14 5 0
Historical thinking as a tool for theoretical psychology on objectivity  in j  martin, j  sugarman  k  l  slaney (eds ), the wiley handbook of theoretical and philosophical psychology methods, approaches and new dir

Historical thinking as a tool for theoretical psychology on objectivity in j martin, j sugarman k l slaney (eds ), the wiley handbook of theoretical and philosophical psychology methods, approaches and new dir

... the natural sciences has a temporality, and what appears as inherently objective at one point in time might not hold true for another Second, already in an earlier publication, Daston and Gallison ... century For instance, Carolus Linnaeus (1707-1778) as an experienced observer in botany, and in selecting and attempting to idealize and synthesize the essential (and not accidental) features of a ... insects, human skeletons, and human body parts in, for instance, atlases According to Daston and Galison (2007), conflicts arose when artists who were to draw essential features did not accept a subordinate

Ngày tải lên: 12/10/2022, 11:51

28 9 0
a novel tool for assessing and summarizing the built environment

a novel tool for assessing and summarizing the built environment

... The final variable list was organized into a GPS-enabled database ideal for editing in the field, which was created in ArcCatalog and readable in Microsoft Access Separ-ate spatial datasets, ... Supplemental administrative data We obtained tax parcel data for 2007 from the Durham County Tax Assessor’s office and used parcel boundaries to build the database and to conduct the assessment ... overlaid within the GIS project, were created to hold data records for tax parcel centroids, nuisances, and sidewalks Each spatial dataset included a table containing records for each spatial location

Ngày tải lên: 02/11/2022, 08:51

13 5 0
Collaborative Action Inquiry- A Tool for and Result of Parent L

Collaborative Action Inquiry- A Tool for and Result of Parent L

... self-identified as African American, Caucasian, Hispanic, and multiracial All co-researchers reside in urban areas, be that a large urban center or more isolated city with rural surrounding, and suburban ... human capacity and an individual’s ability to contribute; and, d) a liberating and life enhancing activity with the express commitment to practical outcomes that transform structures and relationships ... importance as author voices The use of face-to-face time and virtual space is addressed Implications for parent leadership, transformative knowledge production, and educational change are explored

Ngày tải lên: 02/11/2022, 11:37

13 8 0
Altered Pathway Analyzer: A gene expression dataset analysis tool for identification and prioritization of differentially regulated and network rewired pathways

Altered Pathway Analyzer: A gene expression dataset analysis tool for identification and prioritization of differentially regulated and network rewired pathways

... performed APA analysis of simulated datasets and p53 status NCI-60 cell line microarray data to demonstrate potential of APA for identification of several case-specific altered pathways APA analysis ... which may or may not be differentially regulated We have developed Altered Pathway Analyzer (APA), a microarray dataset analysis tool for identification and prioritization of altered pathways, ... Trang 1Altered Pathway Analyzer: A gene expression dataset analysis tool for identification and prioritization of differentially regulated and network rewired pathways Abhinav Kaushik1, Shakir

Ngày tải lên: 19/11/2022, 11:46

12 1 0
Luận Văn An Evaluation Of The Emporium Model As A Tool For Increasing Student Performance In Developmental Mathematics And College Algebra.pdf

Luận Văn An Evaluation Of The Emporium Model As A Tool For Increasing Student Performance In Developmental Mathematics And College Algebra.pdf

... provided data on student performance in both Intermediate Algebra and College Algebra This study utilized a causal-comparative research design, and both a chi square analysis and independent samples ... of An Evaluation of the Emporium Model as a Tool for Increasing Student Performance in Developmental Mathematics and College Algebra by James K Vallade Submitted to the Graduate Faculty as partial ... Intermediate Algebra in the Emporium format Implications and recommendations for further research are included Trang 5For Michael, Landon, Thomas, and BabyTrang 6Acknowledgments Appreciation goes

Ngày tải lên: 19/06/2023, 09:15

139 6 0
Skkn using facebook as a tool in teaching and reviewing english idiomatic expressions for grade 12th students

Skkn using facebook as a tool in teaching and reviewing english idiomatic expressions for grade 12th students

... Idioms are used daily and repeatedly by native speakers ofEnglish Language Idiomatic expressions are a part of every language'svocabulary and are based on that language history, heritage, and culture.Learning ... buckets/pails One cannot turn cats and dogs in It was raining cats and dogs into the singular, either: *It was raining a cat and a dog). ● The Use of Actives/Passives Normally a transitive verb phrase ... and the conclusion, this research consists of threeparts: - Theoretical and practical background - Introducing and reviewing idioms via Facebook - Results and evaluation PART 2: THEORETICAL AND

Ngày tải lên: 05/08/2023, 10:54

67 2 0
Báo cáo y học: "The NFI-Regulome Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors" pdf

Báo cáo y học: "The NFI-Regulome Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors" pdf

... genes annotated in the database and to improve the annotation features and abilities of the database The rate limiting step for input of data into the database is the manual reading of papers by annotators ... performed maintenance and updating of database functions and contributed to writing the manuscript DHL wrote the PHP and perl scripts to annotate and populate the database and worked on database ... NFI transcription factors Such data will be used when available Utility and Discussion Searching the database and displaying information: Basic Search Page The home page of the database is also...

Ngày tải lên: 10/08/2014, 09:22

10 386 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... bitter and more intense in currant flavor and in overall flavor, and stronger in after-taste than the sample with a regular aroma concentration The heightened aroma concentration caused a slight ... investigation, since there are ambiguous results and evidence for and against on that matter Acknowledgements The authors thank practical trainees Linda van Mierlo and Pascalle Weijzen from Wageningen University,...

Ngày tải lên: 03/04/2013, 21:06

10 599 1
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... (5Â-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3Â) was designed to insert a ClaI restriction site at nucleotide position )6, whereas the reverse primer (5Â-ATCGCCATGGTCCCGGGCATATGGGATC CCTGGAAGTACAGGTTTTCCTTTTTAATGGGTGTC ... ATGGTCCCGGGCATATGGGATCCCTGGAAGTACA GGTTTTCGTCTAGAAGATTTCTGTC-3Â) designed to remove the NTAIL stop codon and to introduce a fragment encoding a TEV cleavage sequence and a NcoI restriction site at position ... two separated reactions yielding products N1 (from nucleotides 1330) and N2 (from nucleotides 331396) N1 was amplied using a forward primer (FWN1: 5Â-TACCG TTAACATCGATATGCATCATCATCATCATCATAC-3Â),...

Ngày tải lên: 18/02/2014, 04:20

14 675 0
w