a tightrope walk between protecting security and losing liberty

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identification and expression of a cDNA encoding human 6622 ... potential interest to reduce life-threatening complications of cerebral malaria, and as an important tool in validating our proposal of hACMSD as a novel drug target for the treatment of diabetes and ... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is...

Ngày tải lên: 18/02/2014, 06:20

9 797 0
Sputum cellularity in pulmonary tuberculosis: A comparative study between HIV-positive and -negative individuals pptx

Sputum cellularity in pulmonary tuberculosis: A comparative study between HIV-positive and -negative individuals pptx

... Santos and collaborators, comparing data between 2001 and 2003 with data between 1991 and 1993, in a city of the state of Santa Catarina, has shown an increase in the number of cases of HIV/AIDS ... Cruz and collaborators, in which the mean age was 41.08 and standard deviation was 14.32 years (Cruz et al., 2008) Silveira and collaborators observed similar results, obtaining a mean age of ... metachromatic cells 0.04% and epithelial cells 4.4% Female gender and atopy are associated with a significant elevation of eosinophils, male-to-female ratio was 0.3% and between atopic and non-atopic...

Ngày tải lên: 22/03/2014, 18:20

7 394 0
Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt

Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt

... 5¢-GTAGGACATGCCAGAggcGCCCCCTTG ACG-3¢, MOslr1417-3 5¢-GCAAACTTTTCCGaTCGgc GATAATCTGAAAACC-3¢, MOslr1417-4 5¢-GGAT TTACCACAACCAgctGTTTGATTAGCATT-3¢ and MOslr1417-5 5¢-CCAAAGGATTTACCggcgCCACAGG ... thaliana IscA1) AC007067.4, P_purp (Porphyra purpurea) NP_053827, Athal2 (Arabidopsis thaliana IscA2) AC005825.3, Athal3 (Arabidopsis thaliana IscA3), AC006921.5, A_ vinIscA (Azotobacter vinelandii ... slr1417 was amplified from chromosomal DNA of Synechocystis PCC 6803 by PCR using the primers PRiscA11 (5¢-GGAATTCCATATGAGCCAAGCCACC GCTACC-3¢) and PRiscA12 (5¢-GATCTAAGCTTAAA CCCCAAAGGATTTACC-3¢)...

Ngày tải lên: 31/03/2014, 01:20

10 449 0
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf

Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf

... transition of calf thymus DNA and its complexes with ActII/ActV determined from DSC measurements All thermodynamic parameters are calculated per mol of DNA base pairs DH and DS, as well as DHbind and DSbind ... Table Binding parameters for ActII/ActV drug–DNA complexation, calculated per mol of ligand at r = 0.33 (ratio of moles of bound ligand to moles of base pairs) Values are mean ± average deviation ... mitoxantrone, ametantrone and its derivatives have shown [9] that variations in the structure –DSbind (calÆmol)1ÆK)1) – DGbind (kcalÆmol)1) ActII–DNA ActIII–DNA ActIV–DNA ActV–DNA Fig Heat absorption...

Ngày tải lên: 31/03/2014, 07:20

8 331 0
Báo cáo toán học: "A simple bijection between binary trees and colored ternary trees" pot

Báo cáo toán học: "A simple bijection between binary trees and colored ternary trees" pot

... T1 and T2 , annex a left child v ′ to v and take T1 and T2 as the left and right subtrees of v ′ respectively See Figure 1(b) for example It is clear that any T ∈ Tn , after Step and 2, generates ... vertex u such that uP or P u forms an L-path Clearly, a leaf can never be R-path or L-path Note that the definition of L-path is different from that of R-path Hence, if P is a maximal R-path, then (1) ... is called a maximal R-path if there exists no vertex u such that uP or P u forms a R-path P is called an L-path, if k and vi is the left child of vi−1 for i k P is called a maximal L-path if there...

Ngày tải lên: 08/08/2014, 11:20

5 262 0
Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc

Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc

... for A5 9V, A5 9V-R (5’-CCTCAAAGTTCTCAGTAACGTCACCTCCAGCTTG-3’) and A5 9V-F (5’-CAA GCTGGAGGTGACGTTACTGAGAACTTTGAGG-3’); for A5 9 S, A5 9S-R (5’-CAAGCTGGAGGTGACTCTACTGAGAACTTTGAGG-3’) and A5 9S-F (5’-CA ... (5’CCAGCTTGTTCCCTGATAACTTCTTCCCCACC-3’) and L51I-F (5’-GGTGGGGAAGAAGTTATCAGGGAACAAGCTGG-3’); for L51T, L51T-R (5’-CCAGCTT GTTCCCTTGTAACTTCTTCCCCACC-3’) and L51T-F (5’-GGTGGGGAAGAAGTTACAAGGGAACAAGCT ... (5’-CA AGCTGGAGGTGACTCTACTGAGAACTTTGAGG3’); for G6 7A, G6 7A- R(5’-GGCATCTGTAGAGTGCGCGACATCCTCAAAGTTC-3’) and G6 7A- F (5’-GAAC TTTGAGGATGTCGCGCACTCTACAGATGCC-3’); and for G67 S, G67S-R (5’-GGCATCTGTAGAGTGCGAGACATCCTCAAAGTTC-3’)...

Ngày tải lên: 10/08/2014, 05:21

15 479 0
Báo cáo y học: "A possible connection between psychosomatic symptoms and daily rhythmicity in growth hormone secretion in healthy Japanese students" potx

Báo cáo y học: "A possible connection between psychosomatic symptoms and daily rhythmicity in growth hormone secretion in healthy Japanese students" potx

... changes in slow wave sleep and REM sleep and relationship with growth hormone and cortisol levels in healthy men J Am Med Asso 2000, 284:861-868 Tanaka H, Tamai H, Terashima S, Takenaka Y, Tanaka ... Microplate Fluorometer (Bio-Rad, USA) with excitation at 485 nm and emission at 590 nm Data analysis The significance of differences between group means was tested by analysis of variance (ANOVA), ... diagnostic and basic investigation Clinica Chimica Acta 2007, 383:30-40 Rantonen PJ, Penttila I, Meurman JH, Savolainen K, Narvanen S, Helenius T: Growth hormone and cortisol in serum and saliva...

Ngày tải lên: 10/08/2014, 09:20

4 265 0
Báo cáo y học: " A rigid barrier between the heart and sternum protects the heart and lungs against rupture during negative pressure wound therapy" doc

Báo cáo y học: " A rigid barrier between the heart and sternum protects the heart and lungs against rupture during negative pressure wound therapy" doc

... NPWT The macroscopic appearance of the heart and lungs was inspected and the area of epicardial petechial bleeding was measured after 12 and 24 hours of NPWT Material and methods Animals A porcine ... The length and width of the area affected by petechial bleeding on the epicardial surface were measured and the area was calculated (Figure 1) Calculations and statistics Anesthesia and surgery ... The cause may be that the heart and lungs are drawn up towards the anterior thoracic wall and forced against the sharp sternal edges during NPWT Inserting a rigid barrier between the heart and...

Ngày tải lên: 10/08/2014, 09:21

5 324 0
Báo cáo y học: "Host gene expression profiling in influenza A virus-infected lung epithelial (A549) cells: a comparative analysis between highly pathogenic and modified H5N1 viruses" ppt

Báo cáo y học: "Host gene expression profiling in influenza A virus-infected lung epithelial (A549) cells: a comparative analysis between highly pathogenic and modified H5N1 viruses" ppt

... gene annotation files and raw data were extracted into MS EXCEL Data Analysis Data was analyzed using GENOWIZ Microarray and Pathway analysis tool (Ocimum Biosolutions, Hyderabad, India) Replicated ... TGCACATGGTGGAGTCAGG 3′; CXCL10 FP 5′ TTCAAGGAGTACCTCTCTCTAG 3′; CXCL10 RP 5′ CTGGATTCAGACATCTCTTCTC 3′; CCL5 FP 5′ TACCATGAAGGTCTCCGC 3′; CCL5 RP 5′GACAAAGACGACTGCTGG 3′; b-ACTIN FP 5′ CATGAAGTGT GACGTGGACATCC ... performed data analysis and bioinformatics studies AKC, SM and ACM wrote the paper All authors read and approved the final manuscript Competing interests The authors declare that they have no competing...

Ngày tải lên: 12/08/2014, 01:21

11 510 0
Báo cáo y học: " Modification of a loop sequence between -helices 6 and 7 of virus capsid (CA) protein in a human " pot

Báo cáo y học: " Modification of a loop sequence between -helices 6 and 7 of virus capsid (CA) protein in a human " pot

... interests 14 Authors' contributions TS and EEN designed the research, AK, AS, YS, and EEN performed the research, TS, MN, AA, and EEN analyzed the data, and AA, HA, TS, and EEN wrote the paper 15 Acknowledgements ... Science, and Technology, and the Ministry of Health, Labour and Welfare, Japan 19 References 20 10 11 Shibata R, Sakai H, Kawamura M, Tokunaga K, Adachi A: Early replication block of human immunodeficiency ... introducing compensating mutations that can overcome these disadvantages and further augment their replicative capabilities in human and simian cells to reach a similar level as seen with SIVmac Conclusion...

Ngày tải lên: 12/08/2014, 23:21

11 237 0
Báo cáo y học: "A possible link between exercise-training adaptation and dehydroepiandrosterone sulfate- an oldest-old female study"

Báo cáo y học: "A possible link between exercise-training adaptation and dehydroepiandrosterone sulfate- an oldest-old female study"

... conditions, ATP demands are immediately increased Carbohydrate fuel, as an anaerobic substrate, has the advantage of having a fast degradation rate and can occur in the absence of oxygen for rapid ATP ... on an ELISA analyzer (Tecan Genios, Salzburg, Austria) with the use of commercially available ELISA kits (Diagnostic Systems Laboratories, Inc Webster, Texas, USA), according to the manufacture’s ... according to the manufacturer’s procedures BP, HR, and arterial oxygen saturation BP and HR were measured quietly and at constant temperature (~ 23°C) Participants were provided with an automated oscillometric...

Ngày tải lên: 31/10/2012, 16:49

7 339 0
A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese

A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese

... singular form (of a noun of a particular class), and ‘teachers’ is plural form (of a noun of a particular class); and the difference between singular forms and plural form is semantically relevant: ... contrastive, not comparative) two values typologies (a CA is always concerned with a pair of languages), and founded on the assumption that languages can be compared.” CA describes similarities and ... • What are the grammatical and semantic features of each verb and how are they similar and different in terms of these features? • What are their synonyms and idioms? • What are the implications...

Ngày tải lên: 06/04/2013, 08:43

52 1,9K 27
A STUDY OF THE RELATIONSHIP BETWEEN CEO COMPENSATION AND FIRM PERFORMANCE IN THE US AIRLINE INDUSTRY 2002 2006

A STUDY OF THE RELATIONSHIP BETWEEN CEO COMPENSATION AND FIRM PERFORMANCE IN THE US AIRLINE INDUSTRY 2002 2006

... Center for Research and Security Prices, Standard and Poor’s Compustat database, and each firm’s annual reports CEO total cash compensation (salary plus bonus), stock option grants and exercise ... immediately 21 and substantially devalued The case can be made that managerial decisions to award CEOs with exorbitant salaries and bonuses while firm performance and thus stock price decreases ... a major controversy among shareholders, in the media and academia, and has experienced pressure in the legislature and economic arenas The literature suggests there are many and varied reasons...

Ngày tải lên: 11/09/2013, 11:44

132 640 0
Tài liệu Protecting SAM and Security Hives phần 1 pptx

Tài liệu Protecting SAM and Security Hives phần 1 pptx

... characters Although with the original LAN Manager password hashing, a 14-character password was no harder to crack than two 7character parts, the introduction of NTLMv2 and Kerberos management of passwordhashing ... of a hacker, because you don't need to plan a remote attack to steal the SAM and Security hives If you can crack some passwords automatically, explain to the users who've specified these passwords ... be at least characters long, use arbitrary combinations of letters and digits, and specify the system policy in relation to password complexity) Pay special attention to protecting the local Administrator...

Ngày tải lên: 26/01/2014, 06:20

7 361 0
Tài liệu Protecting SAM and Security Hives phần 2 pptx

Tài liệu Protecting SAM and Security Hives phần 2 pptx

... in a time delay When renaming the local Administrator account, try to avoid using the word "Admin" in its name Also, consider creating a dummy account named "Administrator", having a long, rather ... additional security, assign a complex password to the account anyway, and restrict its logon hours Restrict the addition of local accounts to the local Administrators group, and require a strong password ... HKEY_LOCAL_MACHINE\SYSTEM\CurrentControlSet\Services\LanManServ er\Parameters registry key For server platforms, create the AutoShareServer value (REG_DWORD) and set it to For workstations, create the REG_DWORD value named AutoShareWks and set...

Ngày tải lên: 26/01/2014, 06:20

7 384 0
Tài liệu Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan docx

Tài liệu Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan docx

... Pakhtunkhwa (Previously: NWFP), 25000, Pakistan Authors’ contributions IA and GP designed research; IA, and PIP conducted research and collected the data; IA and AL analyzed the data; IA wrote the manuscript; ... for a particular nutrient Statistical Analysis All anthropometric measurements were made in duplicate and the means of paired values were used in the analyses The data were statistically analyzed ... Data Age was assessed using official documents (the National Identity Card, NIC) Weight and height were measured and BMI was calculated as weight/height (kg/m ) Waist circumference (WC) and waist-to-hip...

Ngày tải lên: 14/02/2014, 06:20

9 526 0
Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc

... two-partner branch-points of 4626 G Curien et al (Eur J Biochem 270) the aspartate-derived amino-acids pathway and aromatic amino-acids pathway in plant and in microorganisms are such that ux ... thank Marie-Christine Butikofer and Valerie Verne for the ELISA assays We thank Pr Roland Douce and Dr Michel Matringe and Mickaela Homan for critical reading of the manuscript Special ă thanks ... Database and can be accessed at http://jjj.biochem.sun.ac.za/ database/curien/index.html free of charge Fig Phser branch-point in the aspartate-derived amino acid biosynthetic pathway in plants...

Ngày tải lên: 20/02/2014, 02:21

13 907 0
A Survey on Network Security and Attack Defense Mechanism For Wireless Sensor Networks pdf

A Survey on Network Security and Attack Defense Mechanism For Wireless Sensor Networks pdf

... creation of a false stream in a WSN  Mote-class versus laptop-class attacks: In moteclass (sensor-class) attacks, an adversary attacks a WSN by using a few nodes with similar capabilities as ... bogus data Fabrication is an attack on authentication In IJCTT International Journal of Computer Trends and Technology- May to June Issue 2011 fabrication, an adversary injects false data and compromises ... can jam the radio link in its immediate vicinity An attacker with laptop-class devices have greater battery power, a more capable CPU, a high-power radio transmitter, or a sensitive antenna and...

Ngày tải lên: 05/03/2014, 23:20

9 680 0
Saving and Investing: A Roadmap To Your Financial Security Through Saving and Investing ppt

Saving and Investing: A Roadmap To Your Financial Security Through Saving and Investing ppt

... S A ROADMAP TO YOUR JOURNEY TO FINANCIAL SECURITY | Your First Step—Making a Financial Plan What are the things you want to save and invest for? • a home • a car • an education • a comfortable ... staffs, large national operations, and are prepared to service almost any kind of financial transaction you may need Others are small and may specialize in promoting investments in unproven and ... to ask questions about how and how much your adviser is being paid And if the fee is quoted to you as a percentage, make sure that you understand what that translates to in dollars A ROADMAP...

Ngày tải lên: 06/03/2014, 10:20

32 353 0
w