a the major robotic classifications

... Research Institute, Fisheries Research Agency, Suido-cho, Niigata, Japan 2 Kamiura Station, National Research Institute of Aquaculture, Fisheries Research Agency, Kamiura, Oita, Japan 3 National ... Trang 1urchin ) implications of its role as a zinc transporter for gametogenesis Tatsuya Unuma1, Kazuo Ikeda2, Keisuke Yamano3, Akihiko Moriyama4and Hiromi Ohta5 1 Japan Sea National Fisheries ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about

Ngày tải lên: 16/03/2014, 05:20

... Kengo Nakano, Takeshi Funakoshi, Yoshiyuki Kayano, Sayaka Nakao, Nagisa Sakurai, Hiroyuki Iwata1and Rumi Ishisaka Department of Biological Chemistry and1Department of Veterinary Medicine, Faculty ... positions 3 and 6 in a model substrate protein having a sequence MGAAAAAAAA at its N-terminus was performed and the susceptibility of these mutants to protein N-myristoylation was evaluated by metabolic ... Sepharose was from Pharmacia Biotech Other reagents purchased from Wako Pure Chemical, Daiichi Pure Chemicals, and Seikagaku Kogyo (Japan) were of analytical or DNA grade Plasmid construction Plasmid

Ngày tải lên: 16/03/2014, 16:20

... http://www.bjtth.com) The rec-tal temperature was monitored and maintained at 37.5° C with a thermal pad throughout the surgical procedure A scalp incision of 0.5 cm was made at one-third distal area between the ... eye and ear The temporalis was separated to expose the zygoma and squamosal bone A burr hole of 1.5 × 2 mm was made using a 1 mm micro-drill rostal to the anterior junction of the zygoma and the ... (Pharmaceutical Plant of Tiantan Hospital, Beijing, China) The rectal tempera-ture was monitored and maintained at 37.5°C A scalp incision was made behind the superior nuchal line at 0.5 cm The

Ngày tải lên: 18/06/2014, 16:20

... files The following additional data are available with the online version of this paper Additional data file 1 provides the human ALL gene set Additional data file 2 provides the mouse ALL gene ... is greater than the first part of the curves, especially because of the fact that many TAGs can become superficially lost (fail to be classified as TAGs) as a result of various genome rearrangements ... gene set Additional data file 3 provides the human FAM2 gene set Additional data file 4 provides the mouse FAM2 gene set Additional data file 5 provides the human NEW gene set Additional data file

Ngày tải lên: 14/08/2014, 08:20

... W Anatolia, the Taurus and the Amanos as districts) In all likelihood, along the Anatolian Diagonal another, the Cataonian Sector, may spread north-east of the Cilician, increasingly displaying ... consolidated, lower down any delimitation of the Silenetalia odontopetalae against a yet unstudied major submontane and Mediterranean unit as well as against the Parietarietalia judaicae Rivas-Martinez ... acidophyticCaricetalia fuscae (as Swertio hispanicae-Nardetaliastrictae Vural 1996, see below and Byfield & Özhatay,1997) are widespread They add here to the list of themajor Anatolian upland syntaxa and

Ngày tải lên: 09/01/2020, 18:42

... questionnaires A 2015 paper reported the results for the fatigue and physical function measures, again treating them as separate, con-tinuous variables [7] Analyses of these measures, based on an available ... stratification variables that were unavailable in the FOIA dataset However, it appears unlikely that their inclusion would substantially alter the result, and our analyses remain the closest approxima-tion ... paper Other strengths were that each ther-apy group received a substantial dose of therther-apy, and standardised manuals ensured comparability of treatments across centres and therapists Finally,

Ngày tải lên: 10/01/2020, 12:24

... that have a great impact are natural disaster risk, physical risk, risk political and operational risks Regarding, natural disaster risk, it is assessed as having the greatest impact on travel ... behaviour (Roma et al 2019; Dogru et al 2020) The economic benefits are usually appealing as one of the fundamental advantages of participating in the sharing economy (e.g Airbnb) (Tussyadiah & ... philosophy is adapted for this research is the positivistic approach because this research requiring a quantifiable analyses method to gather primary data 3.3 Research Approach As a researcher, it

Ngày tải lên: 19/05/2023, 22:29

... MCSs also affect the application of management accounting in businesses From the models, the author summarizes some factors that have an impact on the application of MCSs as well as management accounting ... control of the operation of the undertakings” The American Accounting Association (AAA) has defined as follows: “Management accounting is the application of appropriate techniques and concepts ... Federation of Accountant IMA The Institute of Management Accountants MACs Management Accounting and Controls MAPs Management Accounting Practices MAS Management Accounting Systems MCSs Management

Ngày tải lên: 19/05/2023, 22:29

... specificity are regulated by post-translational modification or confor-mational changes in the substrates and by the associa-tion between the substrates and their conjugaassocia-tion enzymes [2,3], accumulating ... Trang 1pathways of ubiquitylated substrates for ubiquitin ⁄26Sproteasome-mediated proteolysis Antony S Fatimababy1, Ya-Ling Lin1,2,3, Raju Usharani1, Ramalingam Radjacommare1, Hsing-TingWang1, ... linkage types and thelengths of the ubiquitin chains and their associatedstructural elements An extensive survey of UBA-con-taining factors including several mammalian and yeastUBL–UBA factors

Ngày tải lên: 15/03/2014, 09:20

... in the United Arab Emirates: Ali Abdul Aziz Ali, a.k.a Ammar al Baluchi (Ali), and Mustafa al Hawsawi To a lesser extent, Binalshibh helped fund the plot from Germany 146 We will never know the ... purchasing plane tickets and traveler’s checks Phone records indicate that Ali aided the hijackers through May 2001 and that, thereafter, Hawsawi became the primary facilitator A notebook Al-Hawsawi ... reports to the contrary, there is no evidence that the Spanish al Qaeda cell, led by Barkat Yarkas and including al Qaeda European financier Mohammed Galeb Kalaje Zouaydi, provided any funding

Ngày tải lên: 15/03/2014, 10:20

... glycosylated at Asn300 (BP1a) and the other (BP1b) nonglycosylated [6,7] The major glycan chain in BP1a represents 70% of the total carbo-hydrate content and has as structure Mana1–6(Xylb1– 2)Manb1–4GlcNAcb1–4(Fuca1–3)GlcNAc ... available soon The sequence of the N-terminal part of SPC4 was analyzed by searching for domain database (RPS-BLAST at NCBI: http://www.ncbi.nlm.nih.gov/blast), protein families database (Pfam9Sanger ... integrates several tools for the analysis of domain and family of proteins, clearly showed that SPC4 contains all the fundamental motifs characteris-tic of Class III plant peroxidases The TBLASTN

Ngày tải lên: 16/03/2014, 13:20

... from grass pollens [10,11] The small size of these sub-cellular particles allows them to reach the deeper air-ways and may explain the frequent occurrence of heavy asthma attacks after rainfalls ... 1) and eukaryotic rPhl p 1 The percentage of histamine released into the supernatant is displayed on the y-axis. Trang 8River, Kissleg, Germany) Alkaline phosphatase-conjugatedgoat anti-(rabbit ... creatinase, and the marker proteins gave negative reaction in the glycan staining and appear brown (Fig 2A) Finally, enzymatic deglycosylation with PNGase F resulted in a reduction of molecular

Ngày tải lên: 16/03/2014, 18:20

... Quı´mica Orga´nica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Argentina Trypanosoma cruzi, the parasitic protozoan that causes the American Trypanosomiasis or Chagas ... Trypanosoma cruzi, the parasitic protozoan that causes Chagas disease, contains a major cysteine proteinase, cruzipain This lysosomal enzyme bears an unusual C-terminal extension that contains a ... UV-MALDI-TOF MS analysis of the oligosaccharides released from C-terminal domain by PNGase F treatment in the linear negative-ion mode using nor-harmane as matrix (A) Analysis of the total oligosaccha-ride

Ngày tải lên: 23/03/2014, 15:20

... (21 aa) and an intracellular portion (567 aa), containing a kinase homology (KH) domain, the dimerization domain and the C-terminal catalytic GC domain [1,7] In the absence of ligand, GC-A forms ... with antibodies against PMCA, as a marker for the cell membrane, and extracellular signal-regulated kinase 1⁄ 2 (ERK1 ⁄ 2), as a marker for the cyto-solic fraction, showed that cell fractionation ... reveal poor fragmentation on collision-induced dissociation In view of the important cardiovascular actions of the ANP⁄ GC-A system, the identification and further characterization of the post-translational

Ngày tải lên: 29/03/2014, 09:20

... from the large subunit, suggesting that the large chain was more resistant to proteolytic attack than the small chain The fact that 2S albumin digestion was not affected by preheating at 100
C, at ... remained (Fig 5A) This peak decreased in area and broadened owing to the formation of a range of new fragments as digestion advanced (Fig 5B) As for the phase 1 digests, when analysed in the ... 3Assuming that the UV absorbance was equal for allspecies, analysis of peak areas was used to determine the yield of peptides in the HPLC profile This showed that  25% of the allergen remained intact,

Ngày tải lên: 30/03/2014, 15:20

... CCACTAGGAGTGGGAAAGTAGTTGCTGCTGGCCAGGTTGGCGGTGCTTCCTGAACCTTTAAT HPV33:HI For AATATGACTTTATGCGCCGCCATCAGCACCAGCGAGACCACCTACAAGAACAACAATTTTAAAGAATATATAAG Rev CTTATATATTCTTTAAAATTGTTGTTCTTGTAGGTGGTCTCGCTGGTGCTGATGGCGGCGCATAAAGTCATATT HPV16:BC ... TTTGATGACATCGAAAACGCCAGCGCCTACGCCGCCAACGCCGGTGCTGATAATAGG Rev CCTATTATCAGCACCGGCGTTGGCGGCGTAGGCGCTGGCGTTTTCGATGTCATCAAA HPV33:FGa For ATGTTTGTAAGACACCTGTTCAACAGGGCCGGCGCCTACGGCGAGAACGTTCCCGATGACCTG ... GGCCACCCCTACTTCAGCATCAAGAACCCCACCAACGCCAAGAAGATCCTGGTGCCC Rev GGGCACCAGGATCTTCTTGGCGTTGGTGGGGTTCTTGATGCTGAAGTAGGGGTGGCC HPV16:DE For ACCGGCAACAAGTACCCCGGCCAGCCCGGCGTGGACAACAGGGAGTGCATCAGCATGGAC

Ngày tải lên: 20/06/2014, 02:20

... Trang 13 Ngay sau đó, các nghị sĩ ung hộ Chavez đã quyết định đưa vấn đề này ra thảo luận trước Quốc hội.Kế hoạch bất ngờ và đầy táo bạo này cua ông Chavez theo đánh ... giờ làm việc cua người lao động không quá 6 tiếng/ngày và 36 tiếng/tuần; Nhà nước quản lý việc khai thác dầu khí và tài nguyên, khoáng sản…  Dự thảo Hiến pháp sửa đổi ... Venezuela đã chứng tỏ rằng mô hình cách mạng tại quốc gia Nam Mỹ này là một hình mẫu mới trong thời đại hiện nay và chu nghĩa xã hội vẫn tiếp tục phát triển và đạt được

Ngày tải lên: 05/07/2014, 14:20

... cleavage to form an active enzyme A member of this family, caspase 3 (CPP32, apopain, and YAMA), plays a central role in the execution of apoptosis in mammalian cells, and activation of caspase ... TRAIL-treated cells (Figure 7b) Active caspase 3 proteolytically cleaves and activates, among other targets, PARP involved in DNA repair and DFF40/CAD DNase, the executor of nuclear DNA fragmentation ... apopto-sis-inducing ligand (TRAIL), and caspase 3 activation was measured using the Ac-DEVD-AMC protease assay according to the manufacturer's instructions (BD Biosciences) DNA fragmentation FLSs were

Ngày tải lên: 09/08/2014, 10:22

... Comparini C, Calamassi R, Pazzagli L, Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f. sp. Platani. ... 341–346. 25 Pazzagli L, Cappugi G, Manao G, Camici G, Santini A & Scala A (1999) Purification, characterization, and amino acid sequence of cerato-platanin, a new phyto- toxic protein from Ceratocystis ... search engine [49] for a PMF search in several proprietary and public genomic databases using a tailor-made bioinformat- ics facility. The mascot search was run against all proteins and DNA sequence...

Ngày tải lên: 07/03/2014, 12:20

... clearance and further metabo- lism of the allergen was altered as a result of the inflammation in the lungs of sensitized animals. Up to now there are few data available on the fate of an allergen after ... day 30 displayed an airway inflammation 18 h after treatment, in the same magni- tude as in animals challenged with a third HDM aero- sol on day 30 (data not shown). The animals were killed after ... visual- ized by autoradiography using a PhosphorImager with the image quant software (both from Molecular Dynamics, Sunnyvale, CA, USA). As standards for SDS ⁄ PAGE autoradiography, 75 Se-labelled...

Ngày tải lên: 07/03/2014, 21:20