... other user information in a multidimensional database [5,8] Accumulated data are used for later modification of the services and for long-term decision making LBSs, such as information systems ... detailed information about personal and vehicular mobile behaviors and therefore reveal interesting practical opportunities to find behavioral patterns to be used, for example, in traffic and ... Although the search space for spatiotemporal knowledge is extremely challenging, imposing spatial and temporal constraints on spatiotemporal sequences makes the computation feasible Specifically,
Ngày tải lên: 12/12/2017, 04:50
... Rayleigh waves propagating in elastic half-spaces covered by an elastic layer The secular equation of Rayleigh propagating in an orthotropic half-space coated by an orthotropic layer has been obtained ... explicit secular equations are still not available for these cases) This technique is also applicable for the case when the half-space and the layer are in the sliding contact.[10] The paper also introduces ... Rayleigh waves are employed as theo-retical bases for extracting the mechanical properties of the layers from experimental data, they are therefore the main purpose of any investigation of Rayleigh
Ngày tải lên: 12/12/2017, 07:54
Case-based reasoning as a technique for knowledge management in business process redesign
... CBR systems allow for straightforward storage in relational databases and entry and update by end users As a result it combines the efficiency of data management and retrieval of database systems ... similarity-based case retrieval to find the closest-matching case References Aamodt, A and Plaza, E ‘Case-Based Reasoning: Foundational Issues, Methodological Variations and Systems Approaches’ AI ... based on three stages A generation stage that identifies BPR alternatives based on user requirements and strategic goals, an evaluation stage that applies the workflow analysis and functional
Ngày tải lên: 16/01/2020, 03:52
working-in-partnership-to-make-britains-smart-meter-revolution-a-reality-for-all
... this paper Age UK and Age Cymru, poster and social media used as part of their active engagement Available information online Available information online 50 Figure 3: Annual visitors to partners’ ... and Partnerships Executive, NHF Sources: We have used available data on annual visitors to partners’ websites to calculate capacity for available resources, that contain information about smart ... meter information available on National Union of Students’ website and social media platforms Training and building advisory capacity Advisory capacity Potential combined advisory capacity (millions)
Ngày tải lên: 30/10/2022, 12:53
the transactor book of bits and pieces #1 for all commodore computers! (a collection of the bits and pieces sections from the transactor, v. 4-6)
... enter language load commands manually Syntax is: disk/0.APL Of course, “APL” could be any language by choice Petunia Users Beware! Back around 1978/79, an interface for PET/CBMs was released called ... PRG for SEQ, REL or USR Another variation .subtitute the * for filename patterns This has been discussed before, but now you can look for filenames that match a pattern and are also of a particular ... projects usually take twice as long as the initial estimate -arule that, I’m afraid, will always be “as constant as change” The first Bits Book was no exception, so without further adieu, it's back to
Ngày tải lên: 31/05/2014, 02:01
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
... features are calculated for all phenotypes, thereby allowing systematic and relatively unbiased interrogation of the data Additionally, the use of powerful mature software tools such as Java, ... experiments are a challenge to analyze Here we describe Exhaustive Expansion, a data analysis approach for deriving hundreds to thousands of cell phenotypes from raw data, and for interrogating these ... reveals that the low Average CV was associated with donor stratification Profiles for CD27+ and CD28+ are also shown in Figure 2, and similarly suggest overall low average CVs for individual patient
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT IHV TGTCTGGACTTTACCAGCATGTACCCCAGTATGATGTGCGATCTCAACATCTCT ... GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT AH1 GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC EBV GTGGTGGACTTTGCCAGCCTCTACCCGAGCATCATTCAGGCTCATAATCTCTGT ... GTGGTGGATTTTGCCAGCTTGTACCCCAGTATCATCCAAGCGCACAACTTGTGC RRV GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC HVS GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... fracture may have been avoided in the case of an abnormal bone structure and a deformed endomedul- lary canal as the FRF analysis showed an abnormality and the surgeon was alerted to the situation ... Multiple critical iterations on the initial manuscript were a joint effort of all authors. All authors read and approved the final man- uscript. Appendix The intra-operatively manufactured prosthesis ... Central Page 1 of 10 (page number not for citation purposes) Journal of Orthopaedic Surgery and Research Open Access Research article In vivo evaluation of a vibration analysis technique for
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx
... limitations has led to a situation where damage is continuing and has placed many important items at risk This has created an urgent need for a technique that can capture the information in each ... conservation can continue and no changes are made that are irreversible If the results from a digital approach are not acceptable, the more challenging and expensive physical approach can still be applied ... 125–135, 1997 E Prados, F Camilli, and O Faugeras, “A unifying and rigorous shape from shading method adapted to realistic data and applications,” Journal of Mathematical Imaging and Vision, vol
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Research Article A Simple Technique for Fast Digital Background Calibration of A/D Converters" potx
... algorithm, and can be applied both for narrowband input signals and for baseband signals, with a slight penalty on the analog bandwidth of the converter By improving the signal-to-calibration-noise ratio ... speed and calibration accuracy, due to the statistical Trang 2nature of the background calibration procedure This pro-cedure estimates the (small) error parameters by filtering a signal that contains ... 5compares our technique with other proposed techniques which address the same problem 2 STANDARD DIGITAL BACKGROUND CALIBRATION A pipeline ADC is composed of a cascade of stages that per-form an analog-to-digital
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot
... diagonal elements of R η . Hence, the MAI covariance matrix R η can be approximated as a block diagonal matrix and the block that appears in its main diagonal is given by (A.4).Notethatsuchanapprox- ... decoupled parametric estimation (called hereafter DPE) algorithm is organized in steps and cycles. At each step, one delay parameter is estimated using the infor- mation of already acquired delays. A ... MAI can be treated as a stochastic random pro- cess [16]. Specifically, MAI vector η can be modelled as a zero mean Gaussian vector with covariance matrix R η = E[ηη H ]. Since the channel parameters
Ngày tải lên: 22/06/2014, 22:20
Báo cáo hóa học: " A Gradient-Based Optimum Block Adaptation ICA Technique for Interference Suppression in Highly Dynamic Communication Channels" doc
... component analysis (ICA) is a powerful statis-tical technique that has a wide range of applications It has attracted huge research efforts in areas such as feature extract statistically independent ... this paper, a gradient-based ICA algorithm with optimum block adaptation (OBA/ICA) is developed, which tailors the learning rate for each coefficient in the separation matrix and updates those rates ... selection of learning rate in an intelli-gent way [18–23] In this paper, we propose a gradient-based block ICA algorithm OBA/ICA, which automatically selects the optimal learning rate ICA has been previously
Ngày tải lên: 22/06/2014, 23:20
MONOTONE ITERATIVE TECHNIQUE FOR SEMILINEAR ELLIPTIC SYSTEMS A. S. VATSALA AND JIE YANG Received 27 pdf
... 551–557 A S Vatsala: Department of Mathematics, University of Louisiana at Lafayette, Lafayette, LA 70504-1010, USA E-mail address: vatsala@louisiana.edu Jie Yang: Department of Mathematics, University ... Evans, Partial Differential Equations, Graduate Studies in Mathematics, vol 19, American Mathematical Society, Rhode Island, 1998 G S Ladde, V Lakshmikantham, and A S Vatsala, Monotone Iterative ... Lakshmikantham and S Kă ksal, Monotone Flows and Rapid Convergence for Nonlinear Paro tial Differential Equations, Series in Mathematical Analysis and Applications, vol 7, Taylor & Francis, London,
Ngày tải lên: 23/06/2014, 00:20
Báo cáo toán học: "Products of all elements in a loop and a framework for non-associative analogues of the Hall-Paige conjecture" potx
... mod A to get a1Aa2A · · · akAxA = xA a1Aa2A · · · akA = 1A a1a2· · · ak∈ A Lemma 4.2 If C 6= ∅ is regular, then there exists C′ such that (i) ∅ 6= C′ ⊆ C, Trang 9(ii) P (Cr′) intersects A(Q), and(iii) ... a column, and z as an entry A k-plex is a subset of L in which each symbol appears as a row, column, and entry precisely k times A 1-plex is called a transversal and a k-plex with k odd is called ... G can be partitioned into n mutually disjoint transversals, i.e G has an orthogonal mate In the group case, it is easy to show that having an orthogonal mate Trang 6is equivalent to having at
Ngày tải lên: 07/08/2014, 21:21
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc
... typically smaller for ANFIS-generated plans (by an average of 7.4%) Comparing ANFIS and oFIS for the same cases, PTV coverage was somewhat infe-rior for ANFIS generated plans, although this was a ... (not a clinical dataset) Then we compared a clin-ical prostate case planned using oFIS and ANFIS (trained by oFIS) And finally we compared multiple treatment cases (prostate, head and neck ) planned ... input/output data space was uniformly sam-pled The data samples were divided into three data sets for model training, validation, and testing purposes The generalization capability of the new ANFIS was
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf
... (metachromasia) Normal (compared with host adjacent cartilage) 3 Surface regularity a Thickness of cartilage b Integration of donor with host adjacent cartilage a Total smooth area of the reparative cartilage ... Trang 1Open AccessVol 10 No 4 Research article Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect Hideyuki Koga1, Masayuki Shimaya1, ... for an adequate number of synovial MSCs to attach to the cartilage defect by the local adherent technique, we performed an ex vivo sequential analysis using rabbit synovial MSCs and rabbit cartilage
Ngày tải lên: 09/08/2014, 10:23
A FAIR GLOBALIZATION: CREATING OPPORTUNITIES FOR ALL phần 1 pot
... permitted to adopt a cautious and gradual approach to capital account liberalization and more socially sensitive sequencing of adjustment... Steps have to be taken to build a multilateral framework ... global imbalances are morally unacceptable and politically unsustainable. What is required to change this is not the realization of a Utopian blueprint in one swoop. Rather Prelims Page x Friday, ... Giuliano Amato Ruth Cardoso Heba Handoussa Eveline Herfkens Ann McLaughlin Korologos Lu Mai Valentina Matvienko Deepak Nayyar Taizo Nishimuro François Perigot Surin Pitsuwan Julio Maria Sanguinetti
Ngày tải lên: 09/08/2014, 23:20
A FAIR GLOBALIZATION: CREATING OPPORTUNITIES FOR ALL phần 2 potx
... public debates on global-ization But we have come to agreement on a common goal: a fair globalization which creates opportunities for all We wish to make globalization a means to expand human well-being ... Cohesive societies are built around shared values, which create a moral and ethical framework for private and public action Globalization has not yet created Part I Page 7 Friday, April 16, 2004 ... system also ensures that bilateral economic conflicts do not automatically translate into bilateral political conflicts And the proliferating demands of global security make multilateral coop-eration
Ngày tải lên: 09/08/2014, 23:20
Báo cáo khoa hoc:" The "Statinth" wonder of the world: a panacea for all illnesses or a bubble about to burst" pps
... Trial- Lipid Lowering Arm (ASCOT-LLA): a multicenter randomized control trial Lancet 2003, 361:1149-1158 Cannon SP, Braunwald E, Mc Cabe H, et al.: Pravastatin or Atorvastatin Evaluation and ... of inflammatory and immune responses [38-40] In animal models of heart failure, statins moderate abnormal collagen and β-myosin expression, attenuate increased matrix metalloproteinase activity, ... trial [10] atorvastatin did not reduce the risk of non-fatal MI and CAD death in patients with diabetes and hypertension who had no preexisting CAD Collaborative Atorvastatin Diabetes Study (CARDS)...
Ngày tải lên: 11/08/2014, 08:20
A brand for all seasons? A discussion of brand loyalty approaches and their applicability for different markets
... surfaced 20 years earlier between Jacoby (1975), Jacoby and Kyner (1973) and Tarpey (1974, 1975), and the same issues are again being argued Seeking a cure -all panacea for measuring brand loyalty ... Attitudinal Attitudinal Behavioural Attitudinal Attitudinal Attitudinal Behavioural Behavioural Table I The measures involved, ``attitudinal'' or ``behavioural'', in brand loyalty Downloaded by MAHIDOL ... 322-332 [Abstract] [Full Text] [PDF] Farzana Quoquab, Norjaya Mohd Yasin, Rozhan Abu Dardak 2014 A qualitative inquiry of multi-brand loyalty Asia Pacific Journal of Marketing and Logistics 26:2,...
Ngày tải lên: 24/09/2016, 18:06