a step towards the detection

Báo cáo khoa học: "A step towards the detection of semantic variants of terms in technical documents Thierry Hamon and Adeline " potx

Báo cáo khoa học: "A step towards the detection of semantic variants of terms in technical documents Thierry Hamon and Adeline " potx

... notable (notable deterioration) fausse manoeuvre (wrong operation) action de l'op~rateur (action of the operator) capacit~ interne (internal capacity) capacit~ totale (total capacity) ... the automatic extraction takes one hour and the validation of the links has been done in two hours. The main difficulty is to evaluate the recall in the results because there is no standard ... that general semantic data are useful for the terminology structuration and the synonym detection in a corpus of specialized language. The results show that semantic vari- ants can be automatically...

Ngày tải lên: 23/03/2014, 19:20

7 526 0
Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf

Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf

... granulifera, Cassiopea xamachana, Condylactys gigantea, Gorgonia ventalina, Lebrunia danae, Palythoa caribaeorum, Physalia phy- salis, Plexaura homomalla, Stichodactyla helianthus and Zoanthus pulchellus); ... S. magnifica Phylum Annelida, Class Polychaeta, Subclass Palpata, Order Canalipalpata, Suborder Sabellida, Family Sabellidae, Genus Sabellastarte [14] The ‘tentacle crown’ and the ‘body’ parts of ... the kingdom Methazoa (Phyla: Annelida, Urochordata, Echinodermata, Cnidaria, Mollusca, Artropoda) were collected in the north coast of Havana and classified by Cuban specialists at the National Institute...

Ngày tải lên: 07/03/2014, 02:20

16 630 0
 Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

... 146 analyses included in the database were performed using the same “made in USA” equipment as in the included trials and were analyzed using the same software and hardware located at the ... MCG data and angiographic data. Fi- nally, microvascular disease, not associated with de- finable epicardial vessel lesions on angiography, re- sulting in myocardial ischemia can create a false ... CardioGram) in addition to an amplitude histogram, which generates a large inventory of normalized mathematical indexes of abnormality. It is the pattern of these mathematical indexes of abnormality,...

Ngày tải lên: 03/11/2012, 10:58

13 685 0
The small business start up kit   a step by step legal guide, 6 edition

The small business start up kit a step by step legal guide, 6 edition

... different hats: It can be a trade name, a legal name, and a trademark (or service mark) all in one. Legal Name Trade Name Trademarks/Service Marks McDonald’s Corporation McDonald’s McDonald’s French ... has a written partnership agreement that gives a name to the partnership, then that name is the legal name. Otherwise, the legal name of the general partnership is simply the last names of the ... to be a winning strategy for a capital-poor start-up that can’t a ord to underwrite a benefits package. Initial rates of corporate taxation are comparatively low (see “Marginal Tax Rates for...

Ngày tải lên: 05/01/2014, 14:28

377 621 1
Tài liệu THE PLAN A Step-By-Step Business Plan Workbook ppt

Tài liệu THE PLAN A Step-By-Step Business Plan Workbook ppt

... sample. PERSONAL FINANCIAL STATEMENT 20 Notes Payable: In the APPENDIX, include the name and address of the noteholder, original loan balance, current balance, pay- ment amount, and what collat- eral ... Notes Payable: Include the name and address of the noteholder, original loan balance, current loan balance, payment amount, and what collateral is used for security. • Unpaid taxes: Describe the ... life insurance to cover the business debt. MANAGERS & EMPLOYEES Sales/Marketing Manager Operations Manager The Good Earth Organizational Chart Finance MIKE JONES (accountant and owner) 20 years...

Ngày tải lên: 18/02/2014, 00:20

31 388 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... by the electrical potential across the membrane) and occasionally bind to and thus compensate the negative charge on the rotor. The freed positive charge on the stator attracts the next negative ... has only 10 membrane-buried negative charges that are essential for binding the ion and also for the rotational mechanism of the ring. The c ring of I. tartaricus has 11 negative charges that ... with a total of 22 transmembrane helices. This value is identi- cal to the value obtained for the other Na + F 1 F 0 ATP synthases. Additionally, the size of the A. woodii c rings (approximately...

Ngày tải lên: 18/02/2014, 17:20

9 773 0
Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt

Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt

... geographic areas, and DHF has spread from South East Asia to the Western Pacific and the Americas. A substantial number of people travelling to endemic regions are also infected each year. In the last ... disease plays a key role in inducing plasma leakage, shock and hemorrhagic manifestations. Currently, there are no vaccines available against dengue virus, although several tetravalent live-attenuated ... [120] because the kinetic parameters of synthetic peptides based on the natural cleavage sites are generally unfavorable [121]. The NS3 protease in the absence of the cofactor reacts with small model...

Ngày tải lên: 19/02/2014, 00:20

17 465 0
Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf

Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf

... when they perceive a painting as being beautiful and, conversely, whether there are brain areas that are specifically active when they view paintings that they consider to be ugly” (Kawabata and ... (2004); K & Z: Kawabata and Zeki (2004); C-C et al: Cela-Conde and colleagues (2004). 382 M. Nadal et al. the neuroanatomical correlates of aesthetic preference for paintings” (Vartanian and Goel, ... Jacobsen et al. (2006) and the rest resides in the stimuli presented to the participants. Vartanian and Goel (2004) and Kawabata and Zeki (2004) asked their participants to express their aesthetic preferences...

Ngày tải lên: 19/02/2014, 17:20

19 528 0
Hints towards the formation of a more comprehensive theory of life. pptx

Hints towards the formation of a more comprehensive theory of life. pptx

... and the papilionaceous plants, suggested the idea of the former, as the latter in a state of detachment, to our late poetical and theoretical brother; yet a something, that approaches to a graver ... almost all of the same natural family. These we may pass by as exceptions. But the insect world, taken at large, appears as an intenser life, that has struggled itself loose and become emancipated ... exceptions, the irritable power and an analogon of voluntary motion first dawn on us in the vegetable world, in the stamina, and anthers, at the period of impregnation. Then, as if Nature had been...

Ngày tải lên: 30/03/2014, 01:20

40 448 0
mastering xpages [electronic resource] a step-by-step guide to xpages application development and the xsp language

mastering xpages [electronic resource] a step-by-step guide to xpages application development and the xsp language

... follows: #xsp.application.timeout=30 Contents xiii HTTPJVMMaxHeapSizeSet Variable 89 JavaMaxHeapSize Variable 89 JavaMinHeapSize Variable 90 JavaEnableDebug Variable 90 JavaDebugOptions Variable 90 JavaUserClasses ... parameter values can be applied to all applications loaded on the server. A sample file, appropri- ately named xsp.properties.sample, is installed automatically as part of the Domino installation ... detecting the runtime environment and adapting the application markup appropriately; other times, it is more effective to simply have parameters that dictate the appropriate behavior in a particular...

Ngày tải lên: 31/05/2014, 00:46

321 1,2K 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

... bias RRV 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' CFICb ORF 59 bias RRV 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' Gene-Specific Primer MPVDb ORF 59 (RFHV/KSHV) 7 5'-TGAAAATCCACAGGCATGAT-3' 1 The ... GG.GCCCAATT AC GT C.C.GCGG.G.TATTT .AG.CAGGCT RFHVMn A T CACA G GAGA. . C T GACGGAT CCTGGT GCGCGTAA.C A CTGA TCC.CAATGC .A KSHV A C T CAC G.GT GAC.G . C T GAAGGTT.ACCTGT. CG .A C C.ACCT CCTAAAAG.TC. ... from the antisense strand. OSM-Mn CCTCGGGCTCAGGAACAAC GTC TACTGCATGGCCCAGCTGCTGGACAA CTCAGACATGA CTGAGCCCACGAAGGCC OSM-AGM A OSM-Human A C.G T OSMa Primer OSM-FAM Probe OSMb Primer Standard...

Ngày tải lên: 18/06/2014, 22:20

12 510 0
Báo cáo hóa học: "Biocompatible micro-sized cell culture chamber for the detection of nanoparticle-induced IL8 promoter activity on a small cell population" pot

Báo cáo hóa học: "Biocompatible micro-sized cell culture chamber for the detection of nanoparticle-induced IL8 promoter activity on a small cell population" pot

... using the forward primer 5’-ata ctc gag ggg tac ctt cgt cat act ccg tat ttg ata agg aac a- 3’ and the reverse primer 5’-aga att cgc ata gat ctt ccg gtg gtt tct tcc tgg ctc tt-3’, containing the ... culture chamber is that the entire cell culture area can be analyzed quickly with better optical quality and without any changes of the cell behavior. Another advantage of the MCC is that optimal focus- ing ... and the MCC presents a more sensitive and cost-efficient in vitro method. Advantages of the quantitative analysis via MCC are the low sample volume, the small amount of test materials, the capture of...

Ngày tải lên: 21/06/2014, 00:20

14 639 0

Bạn có muốn tìm thêm với từ khóa:

w