a statistical parser for czech

... variability of the ovulation rate is a bias source already shown by Dnvts et al (1982 a) For example, an FF ram may have a very low breeding value for ovulation rate (compared to the mean of the FF) which ... Trang 1A statistical model for genotype determinationat a major locus in a progeny test design J.M ELSEN Jacqueline VU TIEN KHANG Pascale LE ROY Institut National de la Recherche Agronomique, ... of all the variables The realizations of these random variables are denoted y, , y,,, y, and y respectively. 3 Notation for probabilities For ease of presentation, we shall use the same notation

Ngày tải lên: 09/08/2014, 22:22

... (AAAAAA, AA), (AAAAAB, AB), (ABBBBB, AB), (BBBBBB, BB) 6n unbalanced amplification 10 6 (AAAAAA, AA), (AAAABB, AB), (AABBBB, AB), (BBBBB, BB) 6n unbalanced amplification 11 6 (AAAAAA, AA), (AAABBB, ... 4n balanced amplification 7 5 (AAAAA, AA), (AAAAB, AB), (ABBBB, AB), (BBBBB, BB) 5n monoallelic amplification 8 5 (AAAAA, AA), (AAABB, AB), (AABBB, AB), (BBBBB, BB) 5n unbalanced amplification ... AA), (AAAA, AB), (BBBB, AB), (BBBB, BB) 4n somatic LOH 15 5 (AAAAA, AA), (AAAAA, AB), (BBBBB, AB), (BBBBB, BB) 5n somatic LOH 16 6 (AAAAAA, AA), (AAAAAA, AB), (BBBBBB, AB), (BBBBBB, BB) 6n somatic

Ngày tải lên: 09/08/2014, 22:23

... results of 100 trials of cross-validation For each trial, the dataset was randomly separated into two halves: one half as training data and the other as testing data to estimate the accuracy of the ... stage, we repeated the analy-sis in other stages, including late embryo, larval stages and young adult Although the exact values of correla-tion coefficients vary across stages, the spatial patterns ... using tran-scripts that are at least 4 kb away from any other known transcripts, and again obtained similar correlation patterns (Figure S3 in Additional file 3) Furthermore, analysis based on

Ngày tải lên: 09/08/2014, 22:23

... C-X, Casella G: Statistical Genetics of Quantitative Traits: Linkage, Maps, and QTL Springer-Verlag, New York 2007 31 Dryden IL, Mardia KV: Statistical Shape Analysis... al.: A statistical ... development, adaptatio n, domestication, and human health. In the past dec- ades, the increasing availability of DNA-based markers has inspired our hope to map genes or quantitative trait loci (QTLs) for ... formation and variation. Shape Analysis According to the definition of Kendall [31], “shape is all the geometrical information that remains when location, scale and rotational effects are filtered

Ngày tải lên: 13/08/2014, 16:20

... American English, Japanese and Hawaiian Among these five languages, Japanese and Hawaiian are known as languages with a few syllable types; Mandarin and Cantonese are the language with a moderate ... number of syllable types; American English has a large number of syllable types The HA approach predicts that, in these five language, an average Japanese word or an average Hawaiian word would ... has been taken on among 12 bilingual native speakers, who can speak both Mandarin and Cantonese The candidates are asked to translate an amount of Mandarin words to Cantonese The experiment aims

Ngày tải lên: 26/09/2015, 09:57

... of infectious diseases and their methods are also applied to real data Although the mathematical models are elegant, there are still some reasons that more practical statistical models should ... protozoan and fungal parasites fall into the micro-parasitic category In addition, we assume that the disease is spread by a contagious mechanism so that contact between an infectious individual and ... Trang 1A STATISTICAL MODEL FOR THE TRANSMISSION OF INFECTIOUS DISEASES WANG WEI NATIONAL UNIVERSITY OF SINGAPORE Trang 2A STATISTICAL MODEL FOR THE TRANSMISSION OF INFECTIOUS DISEASES WANG

Ngày tải lên: 26/09/2015, 09:57

... (1,1,1): (AA, AA, AA), (AB, AB, AB), and (BB, BB, BB) There are nine genotype vectors consistent with S = (1,1,2): (AA, AA, AA), (AA, AA, AB), (AA, AA, BB), (AB, AB, AB), (AB, AB, AA), (AB, AB, BB), ... potentially spurious variants We refer the reader to the section “Alignment of reads and variant calling of cassava the data was generated and the quality filters applied The data The WGS data consist ... replicates (k) each genotype had We then calcu-lated a mean non-replicate rateμk separately for each k To calculate this, we computed a non-replicate rate for each individual that has k putative

Ngày tải lên: 25/11/2020, 13:02

... form [see Appendix A of Additional file1] ⎛ ⎜ 1 n aa ˆw aa + 1 n Aa ˆw Aa n Aa ˆw Aa 1 n Aa ˆw Aa + 1 n AA ˆw AA ⎞ ⎟ ⎠ , where n aa , n Aa and n AAare the numbers of the females with aa, Aa and ... and AA, respectively, and N = n aa +n Aa +n AA; ˆw aa, ˆw Aa and ˆw AA are the weighted elements for aa, Aa and AA, respectively, with ˆw G = ˆf G  1− ˆf G  (G = aa, Aa, or AA), and ˆf aa= exp ... an X-linked diallelic locus with normal allele a and mutant allele A We only select the females because XCI is unrelated to males For females, suppose that aa, Aa and AA are three genotypes and

Ngày tải lên: 25/11/2020, 13:11

... segmentation, [7] showed that Gaussian seg-mentation applied to log(1 + x)-transformed RNA-seq data performs as well as negative binomial segmentation applied to the raw data Accounting for known ... arrays and methylation data with Illumina Human methy-lation 450k arrays All RNA-seq, SNP and methymethy-lation data were dowloaded from the TCGA open-access HTTP Trang 9Fig 5 AUC for SegCorr and ... technologies (microarrays, RNA-seq) may provide different types of signal (continuous, counts), an appropriate transformation may be applied to make the Gaussian assumption reasonable For example, in

Ngày tải lên: 25/11/2020, 17:06

... Global Names Parser (gnparser) It is a Java tool written in Scala language (a language for Java Virtual Machine) to parse scientific names It is based on a Parsing Expression Grammar The parser ... processing mas-sive sets of data Spark is written in Scala, but can also be used with Python, R and Java languages Spark programs written in Java and Scala are able to run “parser” in a distributed fashion ... “scien-tific name”, and “name-string” in particular ways “Name” refers to one or several words that act as a label for a taxon A “scientific name” is a name formed in compliance with a nomenclatural code

Ngày tải lên: 25/11/2020, 17:43

... so-called extreme-value statistics and accounting for the multi-ple and redundant measurements available within each safety system For a typical CANDU reactor, there are 480 fuel channel as-semblies ... methods, and in-dicates that traditional best estimate CANDU approaches which utilize best estimate simulations for the limiting chan-nel response are inappropriate For any best-estimate anal-ysis, all ... with a standard deviation of 3% For a given set of true val-ues, a Monte-Carlo analysis is performed by applying a ran-dom, normal, and independent uncertainty with standard deviation of 3% to each

Ngày tải lên: 01/11/2022, 08:55

... Trang 1M E T H O D O L O G Y A R T I C L E Open AccessA statistical measure for the skewness of X chromosome inactivation for quantitative traits and its application to the MCTFR data Abstract ... between males and females in mammals There are two copies of X chromosome in mammalian females, one of which is paternal and the other is ma-ternal, while mammalian males have only one maternal X ... South Shatai Road, Baiyun District, Guangzhou 510515, Guangdong, China 2 Guangdong-Hong Kong-Macao Joint Laboratory for Contaminants Exposure and Health, Guangzhou 510006, China BMC Genomic Data Li

Ngày tải lên: 30/01/2023, 20:17

... database using Haar wavelet ages taken from the AT&T Database The second database used was the Essex Faces95 database [35], which contains twenty color images each of seventy-two individuals ... training sets The AT&T (formerly ORL) Database of Faces [17] con-tains ten grayscale images each of forty individuals The im-ages contain variation in lighting, expression, and facial de-tails ... be calculated as a re-sult DWT has also been used for feature extraction in PCA-based approaches [26,27] The Gabor wavelet in particular has been used extensively for face recognition applications

Ngày tải lên: 22/06/2014, 06:20

... Braem1, Marie-Noëlle Lelay-Taha1, Audrey Brisebarre1, Florian Atger1, Thierry Gostan1, Michặl Weber1, Guy Cathala1and Thierry Forné1* Abstract Background: Despite its critical role for mammalian gene ... interaction Since this modulation was similar at all loci investigated, we plotted all the data into a single graph (Figure 2a) Sta-tistical analyses indicated a significant increase of random ... locus, for anchor sites R9/F25/F35 and F48, 36/40/40 and 38 sites, respectively Primer extension For each biological sample and each extension primer (1F, cagtccagtgagacacatggttg; FA1, gttaaacccacagggcaa-gagc),

Ngày tải lên: 09/08/2014, 22:24

... harmonics can reach from only small adjustments of the fundamental oscillations to generating additional maxima, minima or plateaus Comparison method (Fourier ANOVA) A statistical test for comparing ... N, Kowa H, Nakashima K: Cosinor analysis of heart rate variability in ambulatory migraineurs Headache 2000, 40(6):457-63. 29 Munakata M, Imai Y, Minami N, Sasaki S, Ichijyo T, Yoshizawa M, Sekino ... orthonor-mal basis and change basis Statistical methods are applied to search for single coordinates of the data (rela-tive to the new basis) that are “large” compared to the other coordinates The

Ngày tải lên: 10/08/2014, 09:20

... inheritance &dquo; In this model a monogenic component is added to the assumed polygenic variation When two alleles A and a are segregating at a major locus, three genotypes are possible (AA, Aa, ... statistical tests of the segregation of a major gene are compared. The first (I for "segregation analysis") is the classical ratio of the likelihoods under Ho (no major gene) and H (a ... They also helped determine boundaries for critical regions in samples of a limited size We used the Harrel and Davis (1982) method to estimate quantiles at 5 and 1% and their jackknife variance as

Ngày tải lên: 14/08/2014, 20:20

... Mustapha 2017) Trang 83 Methodology As we have already stated in this paper we present a statistical analysis of the central indices of the main African Stock Exchanges For this statistical analysis ... mean (also called the expected value) of the set, while a high standard deviation indicates that the values are spread out over a wider range.9 The standard deviation of a random variable, statistical ... stock markets in the sub-Saharan Africa, the African Stock Exchange Association was established in Kenya in 1993, with the aim of providing a formal framework for mutual stock exchange cooperation

Ngày tải lên: 11/07/2020, 03:45

... oligonucleotide array data based on variance and bias Bioinformatics 2003;19:185–93. 16 Marioni JC, Mason CE, Mane SM, Stephens M, Gilad Y RNA-seq: an assessment of technical reproducibility and comparison ... analyze an RNA-seq data of two species, human and mouse, and the results indicate that the SCBN method delivers a more satisfactory performance than the median method Compared to the RNA-seq data with ... GRF-11303918 and GRF-11331016 Bingqing Lin’s research was supported by the National Natural Science Foundation of China (Grant No 11701386). Availability of data and materials The data sets supporting

Ngày tải lên: 25/11/2020, 12:07

... SLALOM (for StatisticaL Analysis of Locus Overlap Method), to perform comparative analysis of sequence annotations in a highly flexible way SLALOM implements six major operation modes and a number ... Conclusion: SLALOM is a highly versatile, command-line based method for comparing annotations in a collection of sequences, with a statistical read-out for performance evaluation and benchmarking of ... a predictor to a golden standard of manually curated annotations In this case, we want to compute performance measures The measures are based on such * Correspondence: bianca.habermann@univ-amu.fr

Ngày tải lên: 25/11/2020, 14:55

... overall approach was as follows We used two data sets, one as training data and one as validation data (Table 1) The training data set was used with exhaustive leave-one-out cross-validation for ... negative weights for factor II for po-sitions 1 and 5 and for factor IV for popo-sitions 1, 3, and 4 A negative value for Atchley factor II correlates with amino acid residues that appear frequently ... two diagnosis categories, RRMS or other neurological disease, with 87% accuracy by leave-one-out cross-validation on training data (N = 23) and 72% accuracy on unused data from a separate study

Ngày tải lên: 25/11/2020, 17:26