a space odyssey full movie with subtitles

A simple introduction to working with LVM

A simple introduction to working with LVM

... this example hda1, hda2, and hda3 are all physical volumes. We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions ... logical volume manager allows you to create and manage the storage of your servers in a very useful manner; adding, removing, and resizing partitions on demand. Getting started with LVM can be a ... metadata type lvm2 Now that we have a volume group (called skx-vol) we can actually start using it. Working with logical volumes What we really want to do is create logical volumes which we can...

Ngày tải lên: 18/09/2012, 10:12

7 676 0
 Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"

Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"

... Harms JF, Welch DR, Samant RS, et al. A small molecule antagonist of the alpha(v)beta3 integrin suppresses MDA-MB-435 skeletal metastasis. Clin Exp Metastasis. 2004; 21: 119-28. 3. Takada ... Sakamoto S, Kyprianou N. Targeting anoikis resistance in prostate cancer metastasis. Mol Aspects Med. 2010 Apr;31(2):205-14. 5. Zanardi LA, Battistini L, Burreddu P, et al. Targeting alpha(v)beta(3) ... organic phase was washed with water, followed by 1N HCl and again water. The organic layer was dried over Na 2 SO 4 and evaporated. The resulting residue was chromatographed on silica gel by...

Ngày tải lên: 25/10/2012, 11:40

14 484 0
OReilly.Building.a.Web.2.0.Portal.with.ASP.NET.3.5.Jan.2008-BBL

OReilly.Building.a.Web.2.0.Portal.with.ASP.NET.3.5.Jan.2008-BBL

... can add more widgets from a widget catalog and decorate the page as they like. How an Ajax-Powered Start Page Is Different The advantages of Ajax and a rich client-side experience give users a ... any part of the Start page asynchronously and give any web site an Ajax look-and-feel. However, UpdatePanel s are a significant drag on the page. The more UpdatePanel s you have, the slower asynchronous ... have already devel- oped one or more web applications and have a good grip on JavaScript and ASP.NET 2.0. The reader is also expected to have basic understanding of ASP.NET AJAX. This information...

Ngày tải lên: 15/11/2012, 14:24

310 491 1
Tài liệu ADX Active Digital Cross-Connect A Space in Time pptx

Tài liệu ADX Active Digital Cross-Connect A Space in Time pptx

... to an SDH multiplexer as a fiber pair rather than as a bundle of 63 copper pairs. This unique feature offers substantial space saving. ADX Active Digital Cross-Connect – A Space in Time Page ... interface cards) Early GSM operators chose TDM because of its many advantages. The technology is time-tested and relatively simple, enabling operators at any given time to know what traffic ... eventually capture a larger share of the average revenue per user (APRU), voice is—and will remain a killer application. Teenagers, craftsmen, businesspeople and just about everyone on the go has come...

Ngày tải lên: 10/12/2013, 20:15

4 298 0
Tài liệu 20 Terabytes a Night  by Doug Rosenberg with Matt Stephens doc

Tài liệu 20 Terabytes a Night  by Doug Rosenberg with Matt Stephens doc

... a night    21  summarizes the challenge facing Jeff and Tim very nicely: The LSST website The science archive will consist of 400,000 sixteen‐megapixel images per night (for 10  years), comprising 60 PB of pixel data. This enormous LSST data archive and object  database enables a diverse multidisciplinary research program: astronomy &  astrophysics; machine learning (data mining); exploratory data analysis; extremely large  databases; scientific visualization; computational science & distributed computing; and  inquiry‐based science education (using data in the classroom). Many possible scientific  data mining use cases are anticipated with this database.  The LSST scientific database will include:      * Over 100 database tables      * Image metadata consisting of 700 million rows      * A source catalog with 3 trillion rows      * An object catalog with 20 billion rows each with 200+ attributes      * A moving object catalog with 10 million rows      * A variable object catalog with 100 million rows      * An alerts catalog. Alerts issued worldwide within 60 seconds.      * Calibration, configuration, processing, and provenance metadata  Sky Movies—Challenges of LSST Data Management  The Data Management (DM) part of the LSST software is a beast of a project. LSST will deal with unprecedented data volumes. The telescope’s camera will produce a stream of individual images  that are each 3.2 billion pixels, with a new image coming along every couple of minutes.  In essence, the LSST sky survey will produce a 10 year “sky movie . If you think of telescopes like  LBT producing a series of snapshots of selected galaxies and other celestial objects, and survey  telescopes such as Sloan producing a “sky map” 22 , then LSST’s data stream is more analogous to  producing a 10 year, frame‐by‐frame video of the sky.   LSST’s Use Cases Will Involve Accessing the Catalogs  LSST’s mandate includes a wide distribution of science data. Virtually anyone who wants to will be  able to access the LSST database. So parts of the LSST DM software will involve use cases and user  interfaces for accessing the data produced by the telescope. Those data mining parts of the  software will be designed using regular use‐case‐driven ICONIX Process, but they’re not the part of  the software that we’re concerned with in this book.  ... a night    21  summarizes the challenge facing Jeff and Tim very nicely: The LSST website The science archive will consist of 400,000 sixteen‐megapixel images per night (for 10  years), comprising 60 PB of pixel data. This enormous LSST data archive and object  database enables a diverse multidisciplinary research program: astronomy &  astrophysics; machine learning (data mining); exploratory data analysis; extremely large  databases; scientific visualization; computational science & distributed computing; and  inquiry‐based science education (using data in the classroom). Many possible scientific  data mining use cases are anticipated with this database.  The LSST scientific database will include:      * Over 100 database tables      * Image metadata consisting of 700 million rows      * A source catalog with 3 trillion rows      * An object catalog with 20 billion rows each with 200+ attributes      * A moving object catalog with 10 million rows      * A variable object catalog with 100 million rows      * An alerts catalog. Alerts issued worldwide within 60 seconds.      * Calibration, configuration, processing, and provenance metadata  Sky Movies—Challenges of LSST Data Management  The Data Management (DM) part of the LSST software is a beast of a project. LSST will deal with unprecedented data volumes. The telescope’s camera will produce a stream of individual images  that are each 3.2 billion pixels, with a new image coming along every couple of minutes.  In essence, the LSST sky survey will produce a 10 year “sky movie . If you think of telescopes like  LBT producing a series of snapshots of selected galaxies and other celestial objects, and survey  telescopes such as Sloan producing a “sky map” 22 , then LSST’s data stream is more analogous to  producing a 10 year, frame‐by‐frame video of the sky.   LSST’s Use Cases Will Involve Accessing the Catalogs  LSST’s mandate includes a wide distribution of science data. Virtually anyone who wants to will be  able to access the LSST database. So parts of the LSST DM software will involve use cases and user  interfaces for accessing the data produced by the telescope. Those data mining parts of the  software will be designed using regular use‐case‐driven ICONIX Process, but they’re not the part of  the software that we’re concerned with in this book.  ... a night    21  summarizes the challenge facing Jeff and Tim very nicely: The LSST website The science archive will consist of 400,000 sixteen‐megapixel images per night (for 10  years), comprising 60 PB of pixel data. This enormous LSST data archive and object  database enables a diverse multidisciplinary research program: astronomy &  astrophysics; machine learning (data mining); exploratory data analysis; extremely large  databases; scientific visualization; computational science & distributed computing; and  inquiry‐based science education (using data in the classroom). Many possible scientific  data mining use cases are anticipated with this database.  The LSST scientific database will include:      * Over 100 database tables      * Image metadata consisting of 700 million rows      * A source catalog with 3 trillion rows      * An object catalog with 20 billion rows each with 200+ attributes      * A moving object catalog with 10 million rows      * A variable object catalog with 100 million rows      * An alerts catalog. Alerts issued worldwide within 60 seconds.      * Calibration, configuration, processing, and provenance metadata  Sky Movies—Challenges of LSST Data Management  The Data Management (DM) part of the LSST software is a beast of a project. LSST will deal with unprecedented data volumes. The telescope’s camera will produce a stream of individual images  that are each 3.2 billion pixels, with a new image coming along every couple of minutes.  In essence, the LSST sky survey will produce a 10 year “sky movie . If you think of telescopes like  LBT producing a series of snapshots of selected galaxies and other celestial objects, and survey  telescopes such as Sloan producing a “sky map” 22 , then LSST’s data stream is more analogous to  producing a 10 year, frame‐by‐frame video of the sky.   LSST’s Use Cases Will Involve Accessing the Catalogs  LSST’s mandate includes a wide distribution of science data. Virtually anyone who wants to will be  able to access the LSST database. So parts of the LSST DM software will involve use cases and user  interfaces for accessing the data produced by the telescope. Those data mining parts of the  software will be designed using regular use‐case‐driven ICONIX Process, but they’re not the part of  the software that we’re concerned with in this book.  ...

Ngày tải lên: 13/12/2013, 00:15

46 397 0
Tài liệu Truyện ngắn tiếng Anh: 2001 A Space odysey ppt

Tài liệu Truyện ngắn tiếng Anh: 2001 A Space odysey ppt

... feet and walked towards it. ' It's a pity about Frank,' Hal said ' Yes,' Bowman answered, after a long pause.' It is.' ' He was an excellent crew member.' Finding ... died. And that's really all I can say.' She smiled pleasantly and straightened up. 'Well, thank you anyway, Doctor. I'm sorry to take up your time.' ' No problem at all,' ... believe or understand. 21 accurately. In a way, this was as amazing as any other feature of TMA-1. Chapter 32 Life in Space Apart from quick meals in the kitchen, Bowman spent almost all his time...

Ngày tải lên: 20/01/2014, 09:21

27 522 0
Tài liệu Báo cáo khoa học: A novel dicyclodextrinyl diselenide compound with glutathione peroxidase activity ppt

Tài liệu Báo cáo khoa học: A novel dicyclodextrinyl diselenide compound with glutathione peroxidase activity ppt

... NADPH were also obtained from Sigma. Sephadex G-25 was pur- chased from Pharmacia (Uppsala, Sweden). All the other materials were of analytical grade and obtained from Beijing Chemical Plant (Beijing, ... experi- ment carried out without the mimic, ascorbate, and ferrous sulfate was known as the control group. Biological analysis of mimics against mitochondrial damage Mitochondrial swelling was assayed as ... swelling and a decrease in mitochondria integrity. TBARS content in ferrous sulfate ⁄ ascorbate-treated mitochondria was analyzed by thiobarbituric acid assay [34]. In this assay, thiobarbituric acid...

Ngày tải lên: 19/02/2014, 02:20

9 493 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

... Sequence Forward ompA* 5Â-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG Reverse ompA105 5Â-GCCATGAATATCTCCAACGAG Reverse ompA117 5Â-CATCCAAAATACGCCATGAATATC Forward 5ÂrpsO 5Â-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG Reverse ... 5Â-GCTTCAGTACTTAGAGAC Forward 3ÂrpsO 5Â-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC Reverse 3ÂrpsO 5Â-GAAAAAAGGGGCCACTCAGG Reverse 3ÂrpsO-(T)18 5Â-T(18)GAAAAAAGGGGCCACTCAGG Forward rpsO internal 5ÂGCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG Reverse ... 5ÂGCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG Reverse 3ÂrpsO-(C)18 5Â-C(18)GAAAAAAGGGGCCACTCAGG Reverse 3ÂrpsO-(G)18 5Â-G(18)GAAAAAAGGGGCCACTCAGG Reverse 3ÂrpsO-(N)18 5Â-GAATTGCTGCCGTCAGCTTGA Forward oxyS109*...

Ngày tải lên: 19/02/2014, 16:20

10 488 0
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx

Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx

... substrates (Fig. 5G and H) were prepared as described previously [11,15]. ATP-dependent DNA helicase and DNA-dependent ATPase assays The standard DNA helicase reaction was performed in a 10-lL reaction ... Staschke, K .A. , Colacino, J. & Wang, Q.M. (2002) Comparative characterization of two DEAD-box RNA helicases in superfamily II: human translation- initiation factor 4A and hepatitis C virus ... used are given at the top of each lane of each gel. The quantitative data are displayed on the left side of each autoradiogram. In all gels, lane 1 (control) is the reaction without enzyme and lane...

Ngày tải lên: 20/02/2014, 11:20

11 574 0
Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

... first pair was X289 (5Â TgTgCTACTTgCC CTggAA 3Â)andX191. The second pair was X133 (5Â TCC AgAAAAgATCgCAA gATg 3Â) [35] and X300 (5Â AgAgC CAAgCTTTTACT ATCggTT 3Â). The PCR products were fractionated ... Electrical signals after amplification were collected and digitized, at a sampling rate of 25 kHz, with the aid of a computer equipped with an analogue-to-digital interface board (DT2821, Data Trans- lation, ... are clearly more similar to those from cobras than to those found in kraits, mamba and coral snake venom [4–19]. Comparative analysis of Wntx sequences Figure 2A shows a comparison of amino acid...

Ngày tải lên: 21/02/2014, 03:20

10 398 0
Tài liệu Báo cáo khoa học: "WebCAGe – A Web-Harvested Corpus Annotated with GermaNet Senses" docx

Tài liệu Báo cáo khoa học: "WebCAGe – A Web-Harvested Corpus Annotated with GermaNet Senses" docx

... hand-crafted sense-annotated corpora have been available (Agirre et al., 2007; Erk and Strapparava, 2012; Mihalcea et al., 2004), while WSD research for languages that lack these corpora has lagged behind ... the 3rd In- ternational Language Resources and Evaluation (LREC’02), Las Palmas, Canary Islands, pp. 609– 612 Santamar ´ a, C., Gonzalo, J., Verdejo, F. 2003. Au- tomatic Association of Web Directories ... representative examples in Yarowsky’s ap- proach is performed completely manually and is therefore limited to the amount of data that can reasonably be annotated by hand. Leacock et al. (1998), Agirre...

Ngày tải lên: 22/02/2014, 03:20

10 419 0
Hyperspace: A Scientific Odyssey Through Parallel Universes, Time Warps, and the 10th Dimension

Hyperspace: A Scientific Odyssey Through Parallel Universes, Time Warps, and the 10th Dimension

... Carl Friedrich Gauss, the acclaimed "Prince of Mathematicians," one of the greatest mathematicians of all time. Even today, if you ask any mathematician to rank the three most famous ... famous mathematicians in history, the names of Archimedes, Isaac New- ton, and Carl Gauss will invariably appear. Life for Riemann, however, was an endless series of setbacks and hardships, ... governs certain forms of radioactive decay. Because radioactive materials emit heat when they decay or break apart, the weak nuclear force contributes to heating the radioactive rock deep within...

Ngày tải lên: 05/03/2014, 16:14

366 426 0
Báo cáo khoa học: Serine-arginine protein kinases: a small protein kinase family with a large cellular presence potx

Báo cáo khoa học: Serine-arginine protein kinases: a small protein kinase family with a large cellular presence potx

... (Sky1 and Dsk1, respectively); Candida albicans with two (QSAA48 and QS9Q27); Aspergilus niger with nine (A2 QAE4, A2 QB94, A2 QC46, A5 AB23, A2 QWQ2, A2 QX01, A2 QX98, A2 R2M0 and A2 RSV1)]; plants with ... and 1a is nega- tively affected by interaction with scaffold attachment factors B1 and 2. FEBS J 276, 5212–5227. 18 Nakagawa O, Arnold M, Nakagawa M, Hamada H, Shelton JM, Kusano H, Harris TM, Childs ... (2006) Targeting the RNA splicing machinery as a novel treat- ment strategy for pancreatic carcinoma. Cancer Res 66, 3819–3827. 57 Hishizawa M, Imada K, Sakai T, Ueda M, Hori T & Uchiyama T (2005)...

Ngày tải lên: 06/03/2014, 01:20

17 376 0
w