... can be seen that for a high nominal current density, a high fraction of the current is generated at the catalyst layer near the air inlet area, leading to under-utilization of the catalyst at ... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... Catalyst layers The catalyst layer is treated as a thin interface, where sink and source terms for the reactants are implemented Due to the infinitesimal thickness, the source terms are actually...
Ngày tải lên: 05/09/2013, 14:58
... fatty acids and fatty alcohols, sterols and alkanes Natural waxes have a wide range of industrial uses in cosmetics, polishes and coatings, pharmaceuticals, and insecticides Wheat straw contains ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... temperature steam or water with or without acid catalyst During the pretreatments, internally produced acids also serve as a catalyst (“autohydrolysis”) Acid catalyzed hydrolysis and partial degradation...
Ngày tải lên: 05/09/2013, 15:28
Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx
... subject was placed on a highly active antiretroviral therapy (HAART) regimen of abacavir, nevirapine and zidovidine in January 1999, which suppressed plasma and CSF viral loads to below detectable ... Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, Shiraishi M, Aramaki Y, Okonogi K, Ogawa Y, Meguro K, Fujino M: A small-molecule, nonpeptide CCR5 antagonist with highly potent and ... demonstrated major variants in C18L that were distinct from a single variant present in C18E; major variants in C98L that were distinct from a single major variant present in C98E; and major variants...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" pptx
... General Clinical Research Centers Abbott Laboratories, Amylin Pharmaceutical, AstraZeneca Pharmaceuticals LP, Bayer HealthCare LLC, Closer Healthcare, GlaxoSmithKline Pharmaceuticals, King Pharmaceuticals, ... an age- and gender-balanced population of 100 healthy adults a monocentric German study Clin Immunol 2005, 116:192-197 15 Tani S, Nagao K, Anazawa T, Kawamata H, Furuya S, Takahashi H, Iida K, ... purification, the DNA was quantitated on a NanoDrop 8000, to measure concentration and assess the purity of the DNA through standard A2 60 /A2 80 and A2 60 /A2 30 ratios The DNA was diluted to 400 ul total,...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf
... approach to band gap calculation is not particularly accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band ... formation By contrast, using hexadecylamine or oleylamine as a reaction solvent promotes Sn(Et2Dtc)2 decomposition at temperature as low as 85 °C Alkylamines also act as a stabilizing agent for ... metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated temperature did not result in SnS formation...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo y học: " A single site for N-linked glycosylation in the envelope glycoprotein of feline immunodeficiency virus modulates the virus-receptor interaction" ppt
... 16 (page number not for citation purposes) Retrovirology 2008, 5:77 GATTTTTAAGGTATTC (5' MLU) and either 5'-CGAGATATTATAACAGATGTTATTAGCACAT-3' (ENV 7076) or 5' GGTCTTGAATCTGTGAAGTGTACCACATA (ENV ... by amplifying the SU coding sequence with the oligonucleotide primers 5'-CGATCTAGAAACAATAATTATGGCAGAAG-3' and 5'-GGCGGCCGCTGGTACCAC(C/T)AAGTAATC-3' corresponding to the start codon for Env leader ... [37-42] Accordingly, the FL4 cell line has provided the basis for the first commercially available FIV vaccine (Fel-O-Vax FIV, Fort Dodge), approved for use in the USA, Japan, New Zealand and Australia...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo sinh học: "Immediate transfection of patient-derived leukemia: a novel source for generating cell-based vaccines" ppt
... both a cytokine and a chemokine transgene (IL-2 and lymphotactin) by a single human neuroblastoma cell line is a recent example of this strategy [7] The disadvantage of a single cell line approach ... involvement For example, the large amount of tumor material typically available from leukemia patients makes these cells accessible for autologous patient-derived vaccine production A major hurdle ... U2OS cells Nuclear DNA was harvested and amplified from separate samples, error bars indicate the standard deviation from the average of triplicate samples pattern of cell division rates in nucleofected...
Ngày tải lên: 14/08/2014, 19:22
evaluate potential use of gut weed (enteromorpha sp.) as a food source for tilapia (oreochromis niloticus): affect on survival and growth
... same as experiment Statistical analysis Data for all measured parameters were analyzed using Excel, and SPSS for Windows, Version 18.0 Variations from dietary treatment were compared by one way ANOVA ... world Tilapia production were Nile Tilapia Production of Tilapia in Vietnam has been increasing year by year; the farming area has been expanded In 2009, the area of tilapia reached 29,717 ha, production ... values are in the range for normal growth of Tilapia 4.3.2 Survival and Growth performance Survival of Tilapia was not affected by the feeding treatments; all treatments had 100% survival (Table...
Ngày tải lên: 18/11/2015, 19:54
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats
... have the same physicochemical and biological structures as natural tidal flats, and that silt accumulation in the sediment is a key parameter for the creation of a natural-like artificial tidal ... observed variation in the macrobenthos population in the artificial tidal flats and the natural tidal flat The abundance of macrobenthos in the artificial tidal flats increased after May 28 and finally ... paper sludge ash and its beneficial applications for cleaning Ago Bay, Kami Pa Gikyoshi/Japan Tappi Journal, 60(9), 80-88 (in Japanese) Ishii R., Sekiguchi H., Nakahara Y., Jinnai Y (2001) Larval...
Ngày tải lên: 05/09/2013, 09:38
BAMBOO AS A NEW FIBER SOURCE IN THE US PAPER INDUSTRY: A FEASIBILITY ANALYSIS FOR BOOSHOOT GARDENS, LLC docx
... fiber than Booshoot can provide Booshoot can make up for a lack of company resources and capacity by commissioning research on the ideal bamboo for paper pulp as well as information on any unforeseen ... chain listed above For example, if bamboo paper is cheaper and functions well in a variety of end products demand for bamboo paper motivates paper and pulp mills to purchase bamboo as a raw material ... generally dictate demand for paper rolls, with an increase in 67 manufacturing output being favorable for paper manufacturers The state of downstream demand causes significant shifts at each stage of...
Ngày tải lên: 18/03/2014, 02:20
Selling Financial Products - A proven methodology for increasing sales of banking and financial services doc
... Rabobank ■ Rand Merchant Bank (SA) ■ Rating Agency Malaysia ■ Raiffeisen International and RZB ■ Saudi Arabian Monetary Agency ■ Shell ■ Société Générale ■ Standard Chartered Group ■ State Bank ... of Banks, Financial Institutions and Corporates worldwide Some of our clients: ■ ABSA ■ Alpha Bank ■ Axa Investment Managers ■ Bank BPH SA ■ Bank of America ■ Bank of China ■ Bank of Kuwait and ... the Middle East ■ Bank Pekao SA ■ Bank Zachodni WBK SA ■ BBVA Group ■ BNP Paribas ■ Calyon ■ Central Bank of Kuwait ■ Caixa Geral de Depositos ■ China International Capital Corporation ■ Citigroup...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "A Joint Source-Channel Model for Machine Transliteration" doc
... Chinese characters, due to homophone confusion Unlike Japanese katakana or Korean alphabet, Chinese characters are more ideographic than phonetic To arrive at an appropriate Chinese transliteration, ... to capture how source names can be mapped to target names, but rather how source and target names can be generated simultaneously In other words, we estimate a joint probability model that can ... description than that of NCM The actual size of models largely depends on the availability of training data In Table 1, one can get an idea of how they unfold in a real scenario With adequately sufficient...
Ngày tải lên: 31/03/2014, 03:20
Báo cáo hóa học: " Research Article Fully Adaptive Clutter Suppression for Airborne Multichannel Phase Array Radar Using a Single A/D Converter" potx
... to achieve full adaptivity to the clutter, generally the radar system has to undergo a multiple -A/ D (hardware) upgrade where a number of sampled data streams are made available However, for practical ... variance and E{·} denotes the expectation operator The usual assumptions such as patchto-patch statistical independence (zero-mean Gaussian) are made on the clutter as well as target The data ... extensive simulation Another observation based on simulation data as well as MCARM data is that the order of pattern ratio is best to be around half the total number of sensors in the array In our...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot
... reached It may be mentioned here that p, q are all matrices γm and τm are real values corresponding to a particular source position and σ is also a real value As already mentioned, we use the albedo ... no relative motion between the camera and the object, the PSF remains same for all the observations We also assume that the blur is space-invariant, and hence a single blur mask is assumed for ... satisfied We subtract a small value ε from the values sx and s y (estimated geometrically from the image) as these values are already close to the true values Since sx and s y are already normalized...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo hóa học: " A Temperature Window for the Synthesis of Single-Walled Carbon Nanotubes by Catalytic Chemical Vapor Deposition of CH4 over Mo2-Fe10/MgO Catalyst" pptx
... spectrophotometer at room temperature and in a backscattering geometry, with Ar laser at 514.5 nm Results and Discussion Figure shows the Raman spectra for materials grown at different growth temperature (a: ... mg catalyst was put into the quartz tube The temperature was raised to the setting value in Ar atmosphere at a flow rate of 200 mL/min before CH4 was introduced into the reactor at 60 mL/min for ... 10.1103/PhysRevLett.86.131 M Kruger, M.R Buitelaar, T Nussbaumer et al., Appl Phys Lett 78, 1291 (2001) doi:10.1063/1.1350427 N Rajalakshmi, K.S Dhathathreyan, A Govindaraj et al., Electrochim Acta 45, 4511 (2000) doi:10.1016/S0013-4686...
Ngày tải lên: 22/06/2014, 00:20