a shallow clone of a single branch

... plasma and CSF HIV-1 RNA levels The subject was placed on a highly active antiretroviral therapy (HAART) regimen of abacavir, nevirapine and zidovidine in January 1999, which suppressed plasma ... intermediate phase characterized by a continued increase in viral divergence but with a sta-bilisation or decline in viral diversity; and a late phase characterized by a stabilisation of viral divergence ... Wales, Australia, 6 Faculty of Medicine, University of Sydney, Sydney, New South Wales, Australia, 7 Dana-Farber Cancer Institute, Boston, MA, USA, 8 Department of Neurology, Harvard Medical

Ngày tải lên: 18/06/2014, 18:20

... data analysis and manuscript preparation EMB and RP performed data analysis and contributed to manuscript preparation JJB, SMJ, AMG and SRK participated in the design and coordination of the data ... accelerations The investigators concluded that trunk accelerometry may be a more appropriate measure for changes occurring at the hip and trunk and may provide an alternate facet of kine-matic analysis ... that fatigue of the ankle plantar and dorsi-flexors resulted in significant, but transient, changes in sway parameters and ranges of postural control Because impaired postural control may have

Ngày tải lên: 19/06/2014, 08:20

... neuritic plaques, glial activation, neurofibrillary tangle formation, and neuronal loss [1]. The cause of AD is still an area of debate however, there is accumulating epidemiologic, pathologic and genetic ... (using antibodies kindly supplied byELAN Pharmaceuticals) as previously described [36]. Statistical analysis Kruskal-Wallis nonparametric one-way ANOVA analysis was used to determine statistical ... in an animal model of Alzheimer's dis- ease. Nature 2000, 408:982-985. 8. Frenkel D, Maron R, Burt DS, Weiner HL: Nasal vaccination with a proteosome-based adjuvant and glatiramer acetate

Ngày tải lên: 19/06/2014, 22:20

... channel measurements which can be used for channel characterization and capacity analysis [2] Apart from a general overview of OpenAirInterface, in this paper we present OpenAirMesh—a specification ... PHY Table 4: Transport and physical channels Each of the transport channels is mapped to a corresponding physical channel of the same name CH Broadcast Broadcast control channel which houses MAC-layer ... channel state feedback at the transmitters in order to allow for advanced PHY allocation of OFDMA resources via the MAC In addition to the physical channels of Table4, there are two synchronization

Ngày tải lên: 21/06/2014, 18:20

... ˘adariu 1 and Viorel Radu 2 1 Departamentul de Matematic˘a, Universitatea Politehnica din Timis¸oara, Piat¸a Victoriei no 2, 300006 Timis¸oara, Romania 2 Facultatea de Matematic˘a S¸i Informatic˘a, ... gave an affirmative answer to the question of Ulam for Cauchy equa-tion in Banach spaces Let E1and E2be Banach spaces and let f : E1→ E2be such a mapping that Trang 2for all x, y ∈ E1and a δ > ... a single variable We prove the generalized Ulam-Hyers stability of the single variable equation As an application of our result for1.8, the stability for the following generalized functional

Ngày tải lên: 22/06/2014, 06:20

... instance, point estimation of the mean of a distribution identifies a single value as the candidate for the mean, and typically the probability of exactly estimat-ing the mean is zero What this ... task is facilitated by treating one variable at a time Given any variable,x i, and keeping in mind that some ob-served state transitions arise from random perturbations rather than transition ... perturbation proba-bilityP Note that we have defined P as the probability of making a random state selection, whereas in some papers each variable is given a probability of randomly changing If the

Ngày tải lên: 22/06/2014, 19:20

... preceding paragraphs that we can always find the rational part... functions the rational part and the transcendental part of the integral It is evidently of great importance to show that ... which are always practicable And it has been shown, more generally, that we can always determine by means of such operations whether the integral of any given algebraical function is algebraical ... algebraical or... x, are of the third, fourth, orders Of course a similar classification of algebraical functions can be and has been made Thus we may say that √ x, x+ √ x, x+ x+ √ x, are

Ngày tải lên: 28/06/2014, 19:20

... characteristics of the anti-SmD3 peptide (SMP) assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver ... (75.3%), and a remarkable diagnostic efficiency of 76.3% Therefore, this test appears to offer a new approach to serological evalua-tion and diagnosis of SLE Figure 2 Assay performance characteristics ... University of Calgary, Calgary, Canada 3 Vice Director of Autoimmune Diagnostics, Laboratory of Prof Seelig and colleagues, Karlsruhe, Germany Corresponding author: Michael Mahler, m.mahler.job@web.de

Ngày tải lên: 09/08/2014, 06:22

... Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopha- ryngeal Carcinoma in Children: Comparison ... Pediatric Population. Technol Cancer Res Treat 2006, 5:591-596. 24. Penagaricano JA, Papanikolaou N, Yan Y, Ratanatharathorn V: Appli- cation of intensity-modulated radiation therapy for pediatric ... Ewing's sarcoma being the largest (5 patients), followed by juvenile nasopharyngeal fibroma, esthesioneuroblastoma and rhabdomyosarcoma (3 patients each). In addition a review of the available

Ngày tải lên: 09/08/2014, 10:20

... levels Anti-tetanus and anti-pneumococcal (Danish serotypes 2, 6B, 8, 9V, 14, 19F and 23F) antibody titers were measured by ELISA at 14 and 28 days after vaccination by a central laboratory Abatacept ... days after vaccination (μg/ml) 28 days after vaccination (μg/ml) N/A N/A N/A N/A N/A 28.6 (26) Group C (vaccines weeks after abatacept) N/A 12.5 (19) 6.1 (20) Group D (vaccines weeks after abatacept) ... administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects Lee Tay1, Francisco Leon2, George Vratsanos3, Ralph Raymond4 and Michael Corbo3

Ngày tải lên: 09/08/2014, 10:20

... can also affect initiation of the transcription and elongation [44,45] The decrease of transactivation prop-erties of VvMYB5b caused by the mutation, in yeast, can be explained by a decrease of ... RT-PCR analysis of NtCHS (chalcone synthase), NtDFR (dihydroflavonol reductase) and NtANS (anthocyanidin synthase) transcript abundance in stamens and corollas Gene expression is shown relative ... their ability to activate LacZ reporter gene expression was quantified using b-galactosidase activity measurements Each value is the mean ±SD of two independent yeast transformations and each experiment

Ngày tải lên: 11/08/2014, 11:21

... Trang 1R E S E A R C H A R T I C L E Open AccessAnalysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of ... current EST data that the other seven gamma gliadin variants are expressed Identification of Butte 86 gamma gliadins by MS/MS Because neither the NCBI database nor any single EST assembly contained ... of gamma gliadin proteins that may play different functional roles in flour Susan B Altenbach*, William H Vensel, Frances M DuPont Abstract Background: The gamma gliadins are a complex group of

Ngày tải lên: 12/08/2014, 03:21

... areas of the body. Animals were re- strained, and the area was scraped with a sharp spoon until blood was visible. The material ob- tained from the scraped area was transferred into a Vacutainer ... programme like the Danish system, (which has an extremely high guarantee of mange-free status) not be available, a quarantine facility must be used and managed on an all-in, all-out basis. Pigs to ... where 41 of 74 pigs were positive (Dalton & Ryan 1988). Each of these studies emphasizes that thorough precautions and preparations should always be an integral part of a mange elimination

Ngày tải lên: 12/08/2014, 15:20

... differing clinical responses Patient 1 (etanercept) achieved a ΔDAS28 of 1.22 and ΔCD3 of 19, and Patient 2 (ana-kinra) achieved aΔDAS28 of 0.16 and ΔCD3 of -118 There was a significant correlation betweenΔCD3 ... useful Abbreviations Δ: change in; AEC: amino-ethylcarbazole; CASPAR: Classification of psoriatic arthritis; CRP: C-reactive protein; d VAS: disease visual analogue scale; DAS28: disease activity ... necrosis factor; VAS: visual analogue scale. Acknowledgements The authors wish to acknowledge the assistance of Drs Ceara Walsh, Ronan Mullan and Tom Smeets. The digital image analysis aspect of this

Ngày tải lên: 12/08/2014, 15:22

... a researcher of the Centre National de la Recherche Scientifique (CNRS, France). References 1. Das S, Narayanan S, Hari L, Mohan NS, Somasundaram S, Selvakumar N, Narayanan P: Simultaneous ... the analysis (Figure 1). All the study subjects were male, and the median age of the 198 patients with available age was 30 years (range, 20 to 63 years). Of these, 134 patients were new cases and ... acknowledges a scholarship from Ackerman & van Haaren. We express special thanks to the staff of the National Tuber- culosis Reference Laboratory of Georgia for their outstanding work. We are grateful

Ngày tải lên: 12/08/2014, 16:20

... and 2 Department of Animal Nutrition and Management, Swedish University of Agricultural Sciences (SLU), Uppsala, Sweden Email: Branislav Lakic* - branislav.lakic@kv.slu.se; Ewa Wredle - ewa.wredle@huv.slu.se; ... daily during 7 days before and 5 days after a PMI of 24 h. Milk was analyzed for SCC, PMN, fat, protein and lactose, and at some occasions also casein and free fatty acids (FFA). Results: During ... compared in pair wise t-tests at the 5% level. The baseline value, with which values obtained after the PMI were compared, was calculated as the mean of the values for each parameter in all samples

Ngày tải lên: 12/08/2014, 18:22

... emien@biken.osaka-u.ac.jp 1 Department of Viral Infections, Research Institute for Microbial Diseases, Osaka University, Osaka 565-0871, Japan Full list of author information is available at the end of ... Gathuka M, Estes JD, Veazey RS, KewalRamani VN, Lifson JD, Bieniasz PD: A macaque model of HIV-1 infection. Proc Natl Acad Sci USA 2009, 106:4425-4429. 16. Kamada K, Yamashita T, Hatcho K, Adachi ... impaired replicative capability of the virus in human cells. Sequence analysis of the MA-CA region of the adapted virus revealed that the there was a G-to-E single amino acid substitution at

Ngày tải lên: 13/08/2014, 01:20

... anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of epidurals per year) + (1.5 ... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per yr ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data...

Ngày tải lên: 05/03/2014, 15:20

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢...

Ngày tải lên: 07/03/2014, 12:20