a response to a submitted form

... rel- evant We evaluated three approaches to defining intact cell-mediated immune responses to influenza vaccine An approach used often in the literature is to desig- nate arbitrarily a value as the ... standard deviation of the mean average mitogen ratios of the population By these criteria an individual would be considered to have an intact cell-mediated response (CMI~ ) to influenza vaccination ... proliferative responses after vaccination that are bio- logically relevant, that indicate a response to the cur- rent vaccine, and that consider the inherent variability between pre- and postvaccination

Ngày tải lên: 14/02/2014, 07:20

... seroprotected before vaccination, although these differences were not always statistically significant In univariate analysis, age had a significant impact on the response to vaccination as measured by seroconversion, ... with a mean age above or below 75, as a best proxy for age In univariate and multivari-ate analysis, there was a significantly lower response in those over 75 years of age, suggesting that Ab response ... to the very elderly to further gain insights into the impact of age and vaccine response We controlled for every factor for which we could obtain data that may have had an impact on vaccine response,

Ngày tải lên: 28/03/2014, 20:20

... studies Standard Operating Procedures (SOP) and assay validation plans with acceptance criteria are followed in validation studies to further assess assay performance characteristics Regulatory agencies ... defined as the lowest amount of an analyte in a sample that can be quantitatively determined with suita-ble precision and accuracy Due to the lack of a standard reference material to estab-lish a true ... software for mRNA quantification Additional statistical analysis was performed to examine assay accuracy and precision using Microsoft Excel Accu-racy was assessed by % Recovery, (detected value/expected

Ngày tải lên: 18/06/2014, 15:20

... for ligand binding assays [12] as a foundation in which to base the validation of a flow cytometry pharmacodynamic assay and applying the "appropriate" parameters for a cell based cytometry ... individuals) Accuracy, as classically defined for ELISA and mass spectrometry based technologies, is the ability of an assay to measure analyte against a standard or quantitative control (QC) and ... internalization assay is to be used as a measure of pharmacodynamic effect of a CCR2 antagonist, it was also important to demonstrate the abil-ity of the CCR2 antagonist to inhibit the saturating

Ngày tải lên: 18/06/2014, 15:20

... C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, Taguchi H: A novel treatment strategy targeting Aurora kinases in acute myelogenous leukemia Mol Cancer ... inhibitor of AURKB/C and has demonstrated anti-proliferative characteristics in vitro and in vivo for both solid tumors as well as hema-tological malignancies [13-15] For many hemahema-tological malignancies, ... and activation [1] Aurora C is closely related to Aurora B with overlapping functions and similar localization patterns [2] Aurora kinases are overexpressed in both solid and hematological malignancies

Ngày tải lên: 18/06/2014, 22:20

... using antibodies against Iba-1 (Abcam, Cambridge, UK) to detect activated microglia and ICAM-1 (Abcam) Binding was detected using a biotinylated secondary antibody and an ABC standard kit (Vector ... a local inflammatory response to eSNCA that is compar-able to LPS Methods Materials SNCA peptide (rPeptide, Georgia, USA) was maintained as a stock solution of 6μg/μl in phosphate-buffered sal-ine ... revealed that p65 nuclear translocation was elevated in SNCA-treated animals, and that a systemic LPS challenge exacerbated this response (Figure 7) Central LPS causes cell death Cell death via apoptosis

Ngày tải lên: 19/06/2014, 22:20

... doi:10.1186/1756-0500-5-58 Ihsane Hmamouchi (i.hmamouchi@yahoo.fr)Fadoua Allali (fadouaallali@yahoo.fr)Latifa Tahiri (latifatahiri@yahoo.fr)Hamza Khazzani (hamzakhazzani@yahoo.fr)Leila EL Mansouri (la_mansouri1@yahoo.fr)Sanae ... (la_mansouri1@yahoo.fr)Sanae ALI OU Alla (sanae.alioualla@yahoo.fr)Redouane Abouqal (abouqal@invivo.edu)Najia Hajjaj-Hassouni (nhajjajhassouni@gmail.com) ISSN 1756-0500 Article type Research article Submission date ... on a visual analogy scale (VAS) as assessed by the patient) that was judged by the Trang 5investigator to require treatment with an anti-inflammatory agent to control arthritis symptoms; and had

Ngày tải lên: 21/06/2014, 19:20

... today’s tools are easy to buy, easy to own, and easy to use © 2008 Marketo, Inc All rights reserved. Trang 13Marketo Lead ManagementMarketo Lead Management automates lead generation campaigns and ... rate increased from 1.1% to 3.9% for emails targeted using web click data. © 2008 Marketo, Inc All rights reserved. Trang 117 Start a DialogThe goal of an email marketing program is to start a ... two and a half week turnaround time from start to launch for an email campaign to just about two and a half hours.” ─ Joyce Feltham, Trimble MRM © 2008 Marketo, Inc All rights reserved. Trang

Ngày tải lên: 28/06/2014, 12:20

... households’ natural capital Proxies for human capital are household size, labor availability, and education Physical capital considers households’ transportation and means of communication Financial capital ... Note: H - human capital; S - social capital; P - physical capital; F - financial capital; N - Natural capital Figure 1 The Sustainable Livelihood Framework In particular, the study explains why ... different livelihood strategies The assets of households include natural capital, human capital, physical capital, financial capital, and social capital The households’ agricultural land determines the

Ngày tải lên: 06/08/2014, 19:20

... temperatures, radiation, air VPD and air account are radiation interception, photosynthesis, respi-ration, photosynthate allocation, and reserve storage and remobilisation Radiation interception and photosynthe-sis ... minimal and maxi-mal daily air temperatures, mean daily soil temperature at 20 cm depth, daily global radiation, daily hours of sunshine and daily air VPD Hourly values of air temper-ature and radiation ... into two different compo-nents These are a C demand, analogous to an affinity, which drives allocation at low C availability, and a maxi-mum import rate, which controls C allocation at high C availability

Ngày tải lên: 08/08/2014, 14:22

... Kerala, India Email: Shekhar Sharma* - drshekharsharma@gmail.com; KR Hiran - hiran_kr@rediffmail.com; K Pavithran - pavithrank@aims.amrita.edu; DK Vijaykumar - dkvijaykumar@aims.amrita.edu * Corresponding ... Edapally, Ernakulam – 682026, Kerala, India and 3 Department of Medical Oncology, Amrita Institute of Medical Sciences & Research Center, Amrita Lane, Edapally, Ernakulam – 682026, Kerala, ... Medical Sciences & Research Center, Amrita Lane, Edapally, Ernakulam – 682026, Kerala, India, 2 Department of Pathology, Amrita Institute of Medical Sciences & Research Center, Amrita Lane,

Ngày tải lên: 09/08/2014, 04:21

... CATGCTCATTCTCAACCACATCACCAACA Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA ... (Bioscan, Washington, DC, USA) and the fractional conversion of ster-oids was calculated In each case total protein concentration was assessed using a 96-well plate assay kit (Bio-Rad labora-tories Inc., ... preparations, with similar results Regression analysis was performed using Microsoft Excel Table 1 Probes and primer sequences used Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA

Ngày tải lên: 09/08/2014, 08:22

... Monfort1, Natalia Garcia-Giralt1, María J López-Armada2, Joan C Monllau1, Angeles Bonilla2, Pere Benito1 and Francisco J Blanco2 1 Unitat de recerca en fisiopatologia òssia i articular- Institut ... protein analysis The cartilage used for RNA quantification was diced and incubated with RNAlater (Qia-gen Inc., Valencia, CA, USA) overnight at 4°C prior to storage Table 1 Demographic data of cartilage ... collagen in OF and OA cartilage Ratio of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between areas (SP and IP) Aggrecan and type II collagen

Ngày tải lên: 09/08/2014, 08:22

... from baseline. Trang 7abatacept) appeared to be least affected, at least for the teta-nus toxoid This may be due to the fact that a peak antibody concentration in a normal primary immune response ... responded to at least six serotypes Introduction Treatment with abatacept has demonstrated efficacy in patients with active rheumatoid arthritis (RA) and an quate response to methotrexate, and in ... peaks at around 2 weeks [12], we also analyzed the impact on humoral response of the timing of vaccination relative to abata-cept administration Materials and methods Study design This open-label,

Ngày tải lên: 09/08/2014, 10:20

... 5'-gcccagctatgaactccttct-3' and 3'-tgaagaggtgagtggctgtct-5'; INDO: ggtcatggagatgtc-cgtaa-3' and 3'-accaatagagagaccaggaagaa-5'; GTSE1: 5'-acgtgaacatggatgacccta-3' and 3'-gttcgggaaccggattattta-3'; ... CDC2: 5'-ggtcaagtggtagccatgaaa-3' and 3'-ccaggagggata-gaatccaag-5'; and MKI67: 5'-ccccaaccaaaagaaagtctc-3' and 3'-gactaggagctggagggctta-5' Histopathology and immunohistochemistry on paraffin-embedded ... and the following 10 mM primers: β-actin: 5'-ggcatcgtgat-ggactccg-3' and 3'-ctggaaggtggacagcga-5'; LTB: 5'-gaggag-gagccagaaacagat-3' and 3'-tagccgacgagacagtagagg-5'; CCL5: 5'-catattcctcggacaccacac-3'

Ngày tải lên: 09/08/2014, 14:20

... that and that These expressions are given numerical values after estimates of genetic valuesand of variance components are available General formulae can be derived that take into account all ... and their expressions as ratios of a covariance to a variance indicate that they can also be obtained from a linear approximation This comment makes it possible to extend easily the approximate ... Trang 1Original articleMagali SanCristobal-Gaudy Jean-Michel Elsen b Loys Bodin Claude Chevalet a a Laboratoire de génétique cellulaire, Institut national de la recherche agronomique,

Ngày tải lên: 09/08/2014, 18:21

... pQE-ygfZG227A PygfZG227AR GTCCGGTATAACAGGCTTTCTTAAAG PygfZC228AF CTTTAAGAAAGGGGCTTATACCGGACAAG pQE-ygfZC228A PygfZC228AR CTTGTCCGGTATAAGCCCCTTTCTTAAAG PygfZC228SF CTTTAAGAAAGGCTCGTATACCGGAC pQE-ygfZC228S ... GTCCGGTATACGAGCCTTTCTTAAAG PygfZC228MF CTTTAAGAAAGGCATGTATACCGGAC pQE-ygfZC228M PygfZC228MR GTCCGGTATACATGCCTTTCTTAAAG PygfZY229AF TAAGAAAGGCTGTGCTACCGGACAAG pQE-ygfZY229A PygfZY229AR CTTGTCCGGTAGCACAGCCTTTCTTA ... CCATGGCCGCAGTCCCTGCCCCAGACCC pQE-Rv_0811c PRv0811cR AGATCTCCGAATACCGCCGCGCAGCCGC PygfZK226AF CAGCTTTAAGGCCGGCTGTTATACCG pQE-ygfZK226A PygfZk226AR CGGTATAACAGCCGGCCTTAAAGCTG PygfZG227AF CTTTAAGAAAGCCTGTTATACCGGAC

Ngày tải lên: 10/08/2014, 05:21

... aids are, they contribute a great deal of help to language classroom Language is a means of communication so teaching a language should be as varied as living and include as many approaches as ... interested and pay attention to grammar activities 1.2.4 Types of Visual Aids Visual aids are various in type Each type has its own advantages and disadvantages in language teaching and learning but ... of visual aids to teach grammar Effect of using visual aids to teach grammar Difficulties in using visual aids to teach grammar Interview and observation are also carried out to add and confirm...

Ngày tải lên: 18/12/2013, 10:03

... 1.12: Trading book assets & capital 2007: examples Market risk capital requirement as % trading assets Trading assets as % of total assets Trading / market risk capital as % total capital requirements ... relating to the appropriate regulation of bank branches within the European single market and appropriate approaches to deposit insurance Landsbanki operated in the UK as a branch, raising retail ... Financial sector ‘value added’ as a % of GDP increased significantly (Exhibit 1.28) Banking sector profits grew as a % of total profits And the market capitalisation of financial companies, and...

Ngày tải lên: 16/02/2014, 11:20

... seen after natural disasters Because many patients self-evacuate after a terrorist attack, prehospital care may be difficult to coordinate and hospitals near the scene can expect to receive a large ... challenges and barriers in communication, organizational response, standards of care, and surge capacity Meta-leaders build and maintain relationships and establish clear channels of communication ... gradual withdrawal based on gathered information, helps avoid delay • Linear Mobilization of Resources: Linear transition (a form of reactive approach) from normal operations to appropriate response...

Ngày tải lên: 19/02/2014, 03:20