a rational strategy for fluid and volume management

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... is variability in coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children ... Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C http://www.nap.edu/catalog/12793.html Hepatitis and Liver Cancer: A National Strategy for Prevention ... John Ward, Dale Hu, Cindy Weinbaum, and David Bell, Centers for Disease Control and Prevention; Chris Taylor and Martha Saly, National Viral Hepatitis Roundtable; Lorren Sandt, Caring Ambassadors...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... and C http://www.nap.edu/catalog/12793.html Acronyms and Abbreviations AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC American Association for the Study of Liver Diseases ... childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination rates than non-Hispanic white children Regarding vaccination of children and ... Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C http://www.nap.edu/catalog/12793.html H E PAT I T I S A N D LIVER CANCER A National Strategy for...

Ngày tải lên: 06/03/2014, 01:20

253 373 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

... and Adult Viral Hepatitis Coordinator, Bureau of Infectious Disease Prevention, Response, and Services, Massachusetts Department of Health, Jamaica Plain, Massachusetts Alison A Evans Assistant ... populations room as soon as they are stable and washed School-entry mandates have been shown to increase hepatitis B vaccination rates and to reduce disparities in vaccination rates Therefore, ... hepatitis B and hepatitis C are important public health problems and that there are several barriers to prevention and control efforts, such as a lack of knowledge and awareness about chronic...

Ngày tải lên: 22/03/2014, 17:20

4 407 1
Báo cáo hóa học: "Perioperative fluid and volume management: physiological basis, tools and strategies" doc

Báo cáo hóa học: "Perioperative fluid and volume management: physiological basis, tools and strategies" doc

... cinematographic analysis of the passage of dyes Ann N Y Acad Sci 1964, 116:765-73 Page of 27 Chan ST, Kapadia CR, Johnson AW, Radcliffe AG, Dudley HA: Extracellular fluid volume expansion and ... liberation of atrial natriuretic peptide, undifferentiated fluid loading can cause glycocalyx degradation, increase vascular permeability, promote tissue edema formation and therefore may constitute ... intravenous fluid and would enforce the formation of interstitial edema Thus, fluids that mainly remain within the vasculature and maintain oncotic pressure are needed to treat acute loss of plasma...

Ngày tải lên: 21/06/2014, 05:20

8 231 0
Báo cáo y học: "Oral Rehydration Therapy for Preoperative Fluid and Electrolyte Management"

Báo cáo y học: "Oral Rehydration Therapy for Preoperative Fluid and Electrolyte Management"

... disease, was in grade III of the ASA physical status classification and, basically, was not the patient appropriate for the ORT treatment, and it was probable that hyperinflation of the lung was ... a safe and effective therapy for the preoperative fluid and electrolyte management of selected surgical patients Table Eligibility standard for oral rehydration therapy I Patients eligible for ... Japanese with English abstract) Yakuri to Chiryo (Jpn Pharmacol Ther) 2003;31:83953 13 Goseki N, Hiranuma S, Yamazaki S, Maruyama M, Nakajima K, Gen T, Shirataka M Oral rehydration solution for...

Ngày tải lên: 25/10/2012, 10:51

9 489 0
Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot

Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot

... between strands and of b-sheet A to allow partial loop insertion and a patent lower b-sheet A that can act as a receptor for the loop of another molecule and hence form polymers [42,51] This patent ... neuroserpin migrated as a single band on SDS ⁄ PAGE and > 90% was in a monomeric form when assessed by nondenaturing and transverse urea gradient PAGE [56] Purification of Z a1 -antitrypsin and refolding/incubation ... Janciauskiene S, Eriksson S, Callea F, Mallya M, Zhou A, Seyama K, Hata S & Lomas DA (2004) Differential detection of PAS-positive inclusions formed by the Z, Siiyama and Mmalton variants of a1 -antitrypsin...

Ngày tải lên: 30/03/2014, 11:20

13 495 0
Báo cáo sinh học: "Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" docx

Báo cáo sinh học: "Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" docx

... nanoparticle characterization, DC loading and imaging and data analysis CO YZ participated in nanoparticle characterization, DC imaging and data analysis MO participated in nanoparticle characterization, ... the statistical analysis and manuscript preparation DM participated in nanoparticle characterization, DC loading and data analysis VK participated in data analysis and supervised studies related ... [8] At 48 hrs, supernatants from the assay wells were removed and IFN-g measured by ELISA Statistical analysis Data were analyzed by descriptive statistics, calculating the mean and standard...

Ngày tải lên: 18/06/2014, 19:20

10 386 0
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot

Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot

... plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; ... the E plasmid was 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG-3' and the 3' primer used for the U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified ... essential for Vif function J Biol Chem 2005, 280(19):18573-18578 Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T, Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H, Iwai K, Uchiyama...

Ngày tải lên: 13/08/2014, 05:21

13 254 0
Báo cáo sinh học: "Combined analysis of data from two granddaughter designs: A simple strategy for QTL confirmation and increasing experimental power in dairy cattle" potx

Báo cáo sinh học: "Combined analysis of data from two granddaughter designs: A simple strategy for QTL confirmation and increasing experimental power in dairy cattle" potx

... study was QTL confirmation, where the data were analysed separately and a confirmed QTL should show a significant effect in both data sets A second aim was a joint analysis of the two data sets ... trait repeatability animal model For the ADR-design DYD were not available, therefore, estimated breeding values calculated with a BLUP animal model for all six traits were taken from the national ... production traits and somatic cell score in order to conduct a QTL confirmation study and to increase the experimental power Data were exchanged in a coded and standardised form The combined data set...

Ngày tải lên: 14/08/2014, 13:22

20 407 0
Báo cáo y học: "A strategy for extracting and analyzing large-scale quantitative epistatic interaction data" pptx

Báo cáo y học: "A strategy for extracting and analyzing large-scale quantitative epistatic interaction data" pptx

... including a minimum bound based on the average of the standard deviation for many similar double mutants (Additional data file 1) This strategy is conceptually similar to an approach taken for the analysis ... useful for analysis of E-MAP and SGA data, and with fairly straightforward modification, they could also be applied to large-scale chemical-genetic studies Data collection and image capturing ... allowing a natural measure of variation in the standard deviation However, the standard deviation is only an estimate of experimental variability, and, with a relatively small number refereed research...

Ngày tải lên: 14/08/2014, 16:21

14 352 0
Building a business strategy for Vietfund management until 2017

Building a business strategy for Vietfund management until 2017

... asset management, and (5) capital structure management This limitation is necessary and appropriate to financial management practices of SMEs in Vietnam, given information available for research ... institutional and individual investors The always and ultimate goal of VFM is to maintain leading position in Fund Management business in Vietnam profitably and sustainably The total asset under management ... values and aims to satisfy the stakeholders goals It is about behaving ethically and providing a good reputation for the company (CSR ref.) • Strategy as the systematic application of rationality:...

Ngày tải lên: 24/11/2014, 00:12

171 594 2
Marketing Strategy for welding and cutting products in Namviet company.doc

Marketing Strategy for welding and cutting products in Namviet company.doc

... – Dam Thi Le Minh Marketing Strategy for welding and cutting products in Namviet company and year Task of Administrative Department: in charge all issues of administrative human, labor salary ... internal affairs, foreign affairs, equipment office Admin Manager consults human resources for Director and Board of Manager Task of Finance and Accounting Department: responsible for all issues ... young, dynamic human resource and adapt easily - Having good relationships with large corporations such as attracting, oil and gas and shipbuilding to have the advantage of direct sales by the...

Ngày tải lên: 27/10/2012, 16:45

26 875 4
an entity-centric approach for privacy and identity management in cloud computing

an entity-centric approach for privacy and identity management in cloud computing

... SSA, TEA, and ASA The first agent, SSA, maintains a database of information about ABs This information is used for encrypting and decrypting sensitive data and metadata included in ABs Each AB ... B.2.1 Initialization of an AB: An owner of sensitive data provides ABC with sensitive data and metadata, including access control and dissemination control metadata ABC constructs an AB by putting ... together data, metadata, and adding a virtual machine After this stage, the AB becomes an active entity (since it has its own virtual machine) that can perform the remaining steps of this algorithm...

Ngày tải lên: 31/07/2013, 09:43

7 522 0
Tài liệu European strategy for child and adolescent health and development pptx

Tài liệu European strategy for child and adolescent health and development pptx

... triennial study and the Health for All database 74 The toolkit that accompanies the strategy provides additional guidance on information and indicators Stimulating concerted action and collaboration ... morbidity and mortality data will measure adverse health outcomes; • data on financial, human and physical resources and social capital will identify the resources and inputs available; • health determinant ... policy, for example, plays an important role in determining food supply Land usage, carcass grading, and food fortification and preparation techniques all affect the levels of fat, sugar, salt and...

Ngày tải lên: 12/02/2014, 19:20

25 432 0
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

... experiences that allow them to understand the kinds and pace of changes taking place To address the gap in linkages between research and practice, practice and education, and education and research, ... mechanisms for collecting, analyzing, and disseminating information about the current and future markets for accounting professionals and accounting faculty Rational planning requires accurate and current ... professional standards and regulators that prevent accounting researchers access to confidential client and audit firm data necessary for rigorous academic research Resource constraints within firms and at...

Ngày tải lên: 18/02/2014, 01:20

140 391 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP The product was separated from...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Country Cooperation Strategy for WHO and the Republic of Yemen 2008–2013 pdf

Tài liệu Country Cooperation Strategy for WHO and the Republic of Yemen 2008–2013 pdf

... live in urban areas of Sana a, Aden, Taiz, Hodeida, Dhamar and Mukalla Registered refugees in Sana a and Aden are provided with basic health care and education   The maternal mortality ratio of ... Governments of Germany, 29 Country Cooperation Strategy for WHO and Yemen Country Cooperation Strategy for WHO and Yemen Italy, Japan, Netherlands, Oman, Saudi Arabia and United States of America Other ... of clean water and food safety 6.3.5 Strengthening the health management information and integrated surveillance system and building capacity for health systems and operational research that provides...

Ngày tải lên: 18/02/2014, 15:20

64 399 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...

Ngày tải lên: 18/02/2014, 17:20

11 875 0
w