a promising tool for the development of electrochemical cells

Development of a Standard Protocol for the Processing of High Quality Sweetpotato Starch for Noodle Making

Development of a Standard Protocol for the Processing of High Quality Sweetpotato Starch for Noodle Making

... Chapter 11 Development of a Standard Protocol for the Processing of High Quality Sweetpotato Starch for Noodle Making Kuakoon Piyachomkwan1 , Klanarong Sriroth2 , Kanjana Chinsamran2 , Kamlai ... the human diet, especially in Asian countries such as Japan, China, Taiwan, Korea, Vietnam and Thailand There are many kinds of noodles which can be classified according to raw material used, ... Baseline variability of the raw material The variability of the properties of sweetpotato starch produced by micro and small-scale processors in Shandong and Sichuan provinces, China was evaluated

Ngày tải lên: 12/04/2017, 07:28

21 267 1
A minor research on current situation and recommendations for the development of individual customer services in ocean bank – hanoi branch

A minor research on current situation and recommendations for the development of individual customer services in ocean bank – hanoi branch

... without them i ABSTRACT The graduation paper presents filtered data on Ocean bank’s annual reports and compatible information in academic books Through collecting and synthesizing data and raw materials, ... in accordance with a set of both quality and quantity criteria Hence, the paper indicates the strong and the weak points of the bank’s organization to have a comprehensive view of Ocean bank’s ... from the experience of foreign banks like China banks, Japan banks or America banks are highly valuated and more likely to apply flexibly to the bank Firstly, safe standards for credit have to

Ngày tải lên: 13/12/2017, 23:46

69 203 0
A decision making tool for the striking of formwork to GGBS concretes

A decision making tool for the striking of formwork to GGBS concretes

... facilities at Clonee for the duration of the work To Paul O’Hanlon, Area Technical Manager, for assisting with all matters on site in Clonee and to Barry and Gary in the lab for the help with the testing, ... me and to the rest of my family and friends for the support and encouragement they continuously offered that was often not acknowledged, but was always appreciated A Decision Making Tool for the ... especially on Saturdays and on Christmas Eve A word of thanks to Albert Cole of Hammond Concrete Services in the UK for the hire of the elusive LOK Test apparatus Thanks also to Dave Reddy and

Ngày tải lên: 03/11/2019, 10:12

79 70 0
Up-modulation of PLC-β2 reduces the number and malignancy of triple-negative breast tumor cells with a CD133+ /EpCAM+ phenotype: A promising target for preventing progression of TNBC

Up-modulation of PLC-β2 reduces the number and malignancy of triple-negative breast tumor cells with a CD133+ /EpCAM+ phenotype: A promising target for preventing progression of TNBC

... University of Ferrara, Via Fossato di Mortara, 70, 44121 Ferrara, Italy Full list of author information is available at the end of the article © The Author(s) 2017 Open Access This article is ... Silvano Capitani1,5 and Valeria Bertagnolo1* Abstract Background: The malignant potential of triple negative breast cancer (TNBC) is also dependent on a sub-population of cells with a stem-like ... then subjected to RTCA and to cytofluorimetrical analysis Statistical analysis Statistical analysis was performed by using the two-tailed Student’s t-test for unpaired data P values

Ngày tải lên: 06/08/2020, 03:46

11 24 0
UNIPred-Web: A web tool for the integration and visualization of biomolecular networks for protein function prediction

UNIPred-Web: A web tool for the integration and visualization of biomolecular networks for protein function prediction

... di Milano, Via Celoria 18, 20133, Milano, Italy Full list of author information is available at the end of the article networks, often carry complementary information each other, and often a source ... the visual analysis) Once Perlasca et al BMC Bioinformatics (2019) 20:422 Page of 19 Fig Overall organization of the UNIPred-Web application The area (a) allows the specification of the networks ... is drawn and can be manipulated The area (d) reports the operations that can be applied on the integrated network the organism and the GO term of interest are selected, the interface allows the

Ngày tải lên: 25/11/2020, 12:44

19 18 0
ECPred: A tool for the prediction of the enzymatic functions of protein sequences based on the EC nomenclature

ECPred: A tool for the prediction of the enzymatic functions of protein sequences based on the EC nomenclature

... sequences based on the EC nomenclature Alperen Dalkiran1,2, Ahmet Sureyya Rifaioglu1,3, Maria Jesus Martin4, Rengul Cetin-Atalay5,6, Volkan Atalay1,5* and Tunca Doğan4,5,6* Abstract Background: The automated ... https://github.com/cansyl/ECPred/ Authors’ contributions MJM, RCA, VA and TD conceived the idea and the methodological approach AD, ASR, VA and TD performed the system construction AD performed all data analysis AD and ASR ... did not play any role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript Availability of data and materials https://github.com/cansyl/ECPred/

Ngày tải lên: 25/11/2020, 14:35

13 19 0
NECESSITY FOR THE DEVELOPMENT OF MEDIUM-SIZED ENTERPRISES IN HOCHIMINH CITY: A CASE STUDY OF THE ELECTRONIC AND INFORMATION TECHNOLOGY AND MECHANICAL SECTORS

NECESSITY FOR THE DEVELOPMENT OF MEDIUM-SIZED ENTERPRISES IN HOCHIMINH CITY: A CASE STUDY OF THE ELECTRONIC AND INFORMATION TECHNOLOGY AND MECHANICAL SECTORS

... theories of business as the basis for analysis Firstly, the theory of scale and efficiency of business operation states that businesses are geared towards maximizing profits As the size of the business ... rate is and the factors that affect the growth of the business are the cost of production, technology, management capacity, market competition, number of years in operation and legal form of the ... that the larger the scale is, the higher the awareness and the better availability of resources is, the more likely they are to meet the international business standards, the more tendency for

Ngày tải lên: 03/04/2021, 18:19

23 24 0
creation-of-a-novel-tool-for-the-design-and-evaluation-of-uas-propellers

creation-of-a-novel-tool-for-the-design-and-evaluation-of-uas-propellers

... predictions for CLPROP are similar to the experimental results validating the potential accuracy of the aerodynamic calculations of the spreadsheet The power required is a function of the rotational speed ... Systems (UASs) for both military and commercial applications As the utilization of UASs continues to increase, the design of improved propellers for these UASs is an important area for research The ... determined at each radial station This is accomplished by calculating 𝐶𝐿 as a function of the helix angle (𝜙), Prandtl loss factor (𝐹), 𝐵, 𝑟, the tip radius (𝑅), the local wake advance ratio (𝜆𝑊 ), the

Ngày tải lên: 24/10/2022, 02:56

13 3 0
a component based process with separation of concerns for the development of embedded real time software systems

a component based process with separation of concerns for the development of embedded real time software systems

... is an integral part of the analysis transformation chain, the transformation can add information about the cost in time and space of the containers and, in particular, of connectors This is of ... Platform-Specific Model, PSM, or a Schedulability Analysis Model, SAM) and generation of the input for the analysis tools are automated and the results of the analysis are seamlessly propagated ... shown for similar goals by the telecommunications and railways domain, thanks to the interaction between two parallel project frameworks The ESA effort aimed at favouring the adoption of a software

Ngày tải lên: 01/11/2022, 08:29

36 8 0
development of metrics and a complexity scale for the topology of assembly supply chains

development of metrics and a complexity scale for the topology of assembly supply chains

... that has a significant impact on the operation and performance of manufacturing systems [19] Hasan et al [20] argue that ? ?a good layout contributes to the overall efficiency of operations and can ... recognized as structural patterns by graph theory (GT) GT deals with the mathematical properties of structures as well as with problems of a general nature In this context, a graph is a network of nodes ... degree of a graph, denoted by δ(G), are the maximum and minimum degree of its vertices For a vertex, the number of head endpoints adjacent to a vertex is called the in-degree of the vertex and the

Ngày tải lên: 01/11/2022, 09:48

16 6 0
development of a sensor system for the determination of sanitary quality of grapes

development of a sensor system for the determination of sanitary quality of grapes

... when the baseline signal reaches a steady state; the instrument leads to automated reading of the analytical signal and the consequent data treatment Although the analytical method is based on an ... capable of making quantitative estimations directly on the field and to the rather short times available when receiving the grapes in the wine cellar, the evaluation is nowadays made by visual ... processes affect the taste of the wine finally produced For this reason, the sanitary quality of the grapes has to be very carefully evaluated before any processing Due to the lack of portable instruments

Ngày tải lên: 01/11/2022, 09:54

11 6 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... attractiveness, availability, accessibility and affordability of fruits and vegetables? – On which areas related to nutrition, physical activity, the development of tools for the analysis of related disorders, ... national, regional or local level, and to cooperate with similar fora at national level At the same time, the Platform can create input for integrating the responses to the obesity challenge into a

Ngày tải lên: 14/02/2014, 13:20

22 711 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

... Annals of Mathematics A shape theorem for the spread of an infection By Harry Kesten and Vladas Sidoravicius Annals of Mathematics, 167 (2008), 701–766 A shape theorem for the ... (started at (0, 0)) at the point (y, s). Again we shall use the same random walk paths π A for all the full-state processes and the half-space processes, so that these processes are automatically ... present case we can take π B = π A , which has the great advantage that the path of ρ does not depend on the paths of the other particles. This is the reason why the case D A = D B is special. We

Ngày tải lên: 16/02/2014, 06:20

67 491 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

... and that is, that practically all of them are capable of producing their characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere... ... nitrogen and carbon are most available in the form of organic compounds, such as albuminous material. Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria. ... one species from another. As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added. The way that the organism grows in

Ngày tải lên: 16/02/2014, 22:20

201 542 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/or law as classes of strategic tools ... singular choice of edu cation, marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic ... consider the sequencing of the movement of a target across the cells of Figure For example, as members of cell are given opportunities to behave and are made aware of them, they may move to cells

Ngày tải lên: 18/02/2014, 02:20

14 789 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... Furuyama1, Kiriko Kaneko1, Yuanying Ding1, Kazuhiro Ogawa2,*, Miki Yoshizawa1, Masaki Kawamura1, Kazuhisa Takeda1, Tadashi Yoshida3 and Shigeki Shibahara1 Department of Molecular Biology and Applied Physiology, ... HepG2 and HeLa cells were cultured for 48 h under normoxia or hypoxia, and then harvested The microsome fraction was prepared and used for the assay of HO activity The data are means ± SEM of three ... lg of total RNA The lane labeled h contained RNA prepared from untreated cells harvested just before starting the experiment At the bottom of each panel, 28S rRNA of each sample was visualized

Ngày tải lên: 19/02/2014, 06:20

12 623 0
The importance of project management in small- and medium-sized enterprises (SMEs) for the development of new products through E-collaboration docx

The importance of project management in small- and medium-sized enterprises (SMEs) for the development of new products through E-collaboration docx

... E-collaboration Marjan Mohammadjafari 1 *, Shamsuddin Ahmed 1 , Siti Zawiah Md Dawal 1 and Hadi Zayandehroodi 2 1 Department of Engineering, Design and Manufacturing University of Malaya, ... associated with each area, the interaction of the areas with the key project management processes described earlier, available management tools and techniques for each area, and input and outputs ... management is a methodology for managing a project (Ramaprasad and Prakash, 2003). “Project management, including the tools, techniques, and knowledge-based practices applied to manage the

Ngày tải lên: 07/03/2014, 00:20

12 983 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox ... horizontal transfer of vitamin C-related genes In the process of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form ... dehydrogenase reaction is between 7.5 and (Fig 4A) At higher pH values, enzyme activity rapidly decreased, probably because of hydrolysis of the lactone substrate As for the mammalian l-gulono-1,4lactone

Ngày tải lên: 07/03/2014, 12:20

11 574 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

... paradoxa PsbU has a higher homology with the red algal protein than with the cyanobacterial one. The C. paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢), the ... heme c attached. These recombinant proteins were used for pre- paration of the antibodies against red algal PsbQ¢, PsbV and PsbU, cyanobacterial PsbU and green algal PsbQ. The antibodies against ... shown). The behavior of this band in the diatom is thus similar to that of the PsbP- like protein in cyanobacteria [3,12]. The fact that C. gracilis, P. gyrans, L. japonica and U. pinnatifida contained

Ngày tải lên: 23/03/2014, 15:21

11 505 0
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

... during pancreas organogenesis have revealed that the pancreatic precursors already exist before the formation of pancreas buds As early as 14 hpf, the precursors of pancreatic cells are already positioned ... serves as a tissue for haematopoiesis during gestation, the vascular development in liver is essential Angioblasts, precursors of endothelial cells, start to appear near the hepatoblasts at the stage ... base of the epithelial layer and the cell antenna prominent to the luminal surface (Ng et al., 2005) After the yolk is completely absorbed at dpf, anal opening marks the formation of functional...

Ngày tải lên: 11/09/2015, 16:06

199 302 0
w