... surface usually take pace instantly at potentials higher than 1.0 V, revealing as 140 sharp current pulses at the beginning of oxidation after each CV characterization. The double-layer charging ... electrochemical surface area loss for the Pt/CNT catalyst after 168 h oxidation while almost 80% of Pt surface area was lost for the Pt/VXC72R catalyst. Despite the higher electrochemical stability ... relatively high temperature, high potential, oxygen abundant, and aqueous acidic environment at PEMFC cathode, electrochemical oxidation of carbon black support into CO2 can take place in the cathode...
Ngày tải lên: 11/09/2015, 10:03
... phosphata- ses as potential chemical modifiers, and all cellular membranes as potential activating or inactivating scaf- folds. However, the experimental effort actually required can be drastically ... physiologically feasible ranges: 1 2 k 0 ATPase k ATPase 2k 0 ATPase (small variation of the energetic load) 1 5 k 0 ATPase k ATPase 5k 0 ATPase (large variation of the energetic load) 1 50 k 0 ox ... increased value of k ATPase as compared to the value k 0 ATPase ¼ 1:6h À1 . At values of k ATPase exceeding seven-fold of its normal value, no stationary states can be found; that is, k max ATPase ¼...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo sinh học: "Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" docx
... participated in nanoparticle characterization, DC loading and imaging and data analysis. CO YZ participated in nanoparticle characterization, DC imaging and data analysis. MO participated in nanoparticle ... statistical analysis and manuscript preparation. DM participated in nanoparticle characterization, DC loading and data analysis. VK participated in data analysis and supervised studies related ... IFN-g measured by ELISA. Statistical analysis Data were analyzed by descriptive statistics, calculating the mean and standard deviation for continuous vari- ables. The paired Student’s t test was...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" A promising method for identifying cross-cultural differences in patient perspective: the use of Internet-based focus groups for content validation of new Patient Reported Outcome assessments" potx
... methods are used to validate conceptual meaning using phenomenological data (an inductive approach) and quantitative validation activities focus on measurement and operational activities associated ... individuals willing to take part in market research These databases are maintained by market research companies specifically for such purposes Some additional participants were recruited by asking database ... or moderate acne • Seen a dermatologist in the past years for their acne • An oily scalp and were also balding (males only) • Represented Asian, Black, Latino/Hispanic, White/ Caucasian peoples...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC t p.G60V ... Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... using traditional genetic approaches Although functional analyses of rare variants in the Nodal pathway have been performed that confirm their deleterious nature, in many cases these variants are...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: "Lassa virus-like particles displaying all major immunological determinants as a vaccine candidate for Lassa hemorrhagic fever" ppt
... generate a Lassa virus (LASV)-like particle (VLP)-based modular vaccine platform Results: A mammalian expression system that generated large quantities of LASV VLP in human cells at small scale ... platform for designing an optimal vaccine candidate against Lassa hemorrhagic fever, and warrant further investigation in lethal challenge animal models to establish their protective potential ... results established that modular LASV VLP can be generated displaying high levels of immunogenic viral proteins, and that small laboratory scale mammalian expression systems are capable of producing...
Ngày tải lên: 12/08/2014, 01:22
Integrated platinum carbon nanotube based electrocatalyst for high efficiency proton exchange membrane fuel cells 1
... high surface area carbon particles as platinum support instead of using pure Pt black as electrocatalyst, and also by impregnating a small amount of Nafion ionomers into the catalyst layer of ... diffusion layer is usually composed of nanosized carbon blacks spread on the backing layer. These high porosity media can provide mechanical support as well as pathways for electrons, gas and water ... increase the reaction rate of each half-reaction. The best electrocatalyst for each reaction to date is noble metal platinum, a very expensive material. In the 1970s and 1980s the catalyst layer...
Ngày tải lên: 11/09/2015, 10:02
Integrated platinum carbon nanotube based electrocatalyst for high efficiency proton exchange membrane fuel cells 2
... (BET) surface area characterization can provide a relatively accurate way for ex situ surface area measurement. In general, the BET theory is a useful analytical method for the physical adsorption ... that integrates an electrochemical interface (ECI) and a frequency response analyzer (FRA) in one unit. The ECI can be used as a potentiostat or a galvanostat that applies DC polarization on any ... should provide high surface area for metal particles. As such, determination of surface area characteristics of support materials is of vital importance for PEMFC applications. The Brunauer-Emmett-Teller...
Ngày tải lên: 11/09/2015, 10:03
Integrated platinum carbon nanotube based electrocatalyst for high efficiency proton exchange membrane fuel cells 3
... was used as the adsorbate gas. In order for comparison, a pristine carbon paper was also measured for its BET surface area as a reference. The surface areas of the CNT-grown carbon papers obtained ... porosity at different C2H4 flow rate. BET surface area characterization demonstrated that the in situ grown CNT layer had a much larger surface area than that of the pristine carbon paper. Raman spectroscopy ... flow ratio of carbon feedstock gas/carrier gas may lead to a faster CNT growth rate as well as a stimulated lateral growth for the CNTs to convolve with each other. As a result, a dense CNT layer...
Ngày tải lên: 11/09/2015, 10:03
Integrated platinum carbon nanotube based electrocatalyst for high efficiency proton exchange membrane fuel cells 4
... this chapter where fabrication and characterization of an integrated Pt/CNT-based electrocatalyst are intensively introduced. The integrated Pt/CNT-based electrocatalyst was fabricated for ... polarization curves of the Pt/CNTbased MEAs with various Nafion loading at anode. It was observed that a maximized cell performance of the Pt/CNT-based MEA was achieved by combining a 100 µl Nafion ... compositional analysis is of much importance in evaluating the integrated Pt/CNT-based electrocatalyst in that it can provide valuable insights with regard to understanding the electrocatalytic performance...
Ngày tải lên: 11/09/2015, 10:03
THE FATE OF BIODIVERSITY IN MODIFIED TROPICAL FORESTS
... fragmented regions, however, mammalian communities can disappear rapidly, as has been observed for medium- and large-sized mammals in the Brazilian Atlantic Forest (Canale et al 2012) Similar ... relaxation times are generally much more rapid (Halley & Iwasa 2011, Laurance et al 2011), and for ≤100-ha fragments, half of their original species can disappear within 15 years (Ferraz et al ... Combined area of intact and restored forest is the same in all scenarios Target restoration area is not necessarily smaller than area of projected deforestation, but is smaller than combined areas...
Ngày tải lên: 09/09/2015, 11:32
giudelines on small bowel enteroscopy and capsule endoscopy in adults 2008
... data recorder and permanent pacemakers (PPM) and implantable cardiac defibrillators (ICD) The manufacturers of CE have listed them as a relative contraindication for use of CE Small studies have ... commonly missed are Cameron’s ulcers (linear ulceration in large hiatus hernia), varices, peptic ulcer disease43 and gastric antral vascular ectasia (GAVE) which can be diagnosed as gastritis by ... patient has symptoms that warrant investigations earlier.77 The Spigelman classification is used for staging of duodenal polyposis and is based on architectural parameters, grade of dysplasia,...
Ngày tải lên: 13/08/2014, 09:45
a study on backfire control and performance improvement by changing the valve timings in a hydrogen-fueled engine with external injection
... gear moves The changing value of phasing angle for intake camshaft and exhaust camshaft is almost similar As a rough estimation, the cam phasing angle varies a value of around 10CA for each about ... thermal efficiency as a function of fuel-air equivalence ratio 81 for equal energy compensation to a VOP 30CA Fig 4-19 Air mass flow rate as a function of EVC timing for naturally 84 aspirated and ... equivalence ratio for equal 80 energy compensation to a VOP 30CA Fig 4-17 Brake thermal efficiency as a function of fuel-air equivalence ratio 80 for naturally aspirated cases Fig 4-18 Brake...
Ngày tải lên: 13/11/2014, 06:34
Interruption in age based and gender based conversationsstudy on types, outcomes and functions = nghiên cứu về thể loại, tác động và chức năng của sự ngắt lời trong đàm thoại trên cơ sở về tuổi và giới
... having a turn at talk A further claim is that the turn-taking model is a ‘local management system’ but ‘interactionally managed.’ By this way, Sacks, et al mean that turn-taking is managed on a turn-by-turn ... estimative questionnaire responses and actual situations recorded were compared and analyzed to provide the reliable and valid facts and figures - Data Analysis After collecting data, the researcher ... Communication and Language A handbook of theory and practice Basingstok: Palgrave Macmillan 27 Traum, D (1999): Speech Acts for Dialogue Agents In Wooldride, M and Rao, A (Eds.) Foundations of Rational...
Ngày tải lên: 19/12/2013, 10:39
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
... decay and an untimely grave, whose sad fate has been blazoned forth to point a moral or adorn a tale The men also who engage in that contest belong to a class who, from their position, may reasonably ... health A careful analysis of these cases seems to me to shew that if harm really was done by too great a strain being laid upon the system in early life, that harm may generally be accounted for ... the race injured a small vessel at the heart: previous to that he had been a particularly strong muscular man Eleven years after the Boat-Race he was suddenly taken ill and died in a few days."...
Ngày tải lên: 14/02/2014, 21:20
Tài liệu REPORT BY THE DIRECTOR-GENERAL ON THE UNITED NATIONS DECADE OF EDUCATION FOR SUSTAINABLE DEVELOPMENT: INTERNATIONAL IMPLEMENTATION SCHEME AND UNESCO’S CONTRIBUTION TO THE IMPLEMENTATION OF THE DECADE doc
... the media has a very important role to play in advocating for a more sustainable future Media can share information and knowledge thus raising public awareness The media can also change attitudes, ... identification of suitable and relevant indicators at every level – local, national, regional and international – and for each initiative and programme As the Decade puts major emphasis on cooperation ... organize cross-national training and capacity-building United Nations Regions are also working on Decade efforts in a collaborative manner For example, the Asia-Pacific region held a major planning meeting...
Ngày tải lên: 21/02/2014, 17:20
Tài liệu DEVELOPMENT OF STANDARDS OF AOX FOR SMALL SCALE PULP AND PAPER MILLS pdf
... m3/t of paper It appears that small and medium size paper mills are also aware about water conservation and the discharge of waste water has been reduced drastically to achieve the discharge norms ... Neutralisation Tank Buffer UASB Tank Clarifier Reactors 40 Clarifier Bleach Plant Effluent Equilisation Tank Primary Clarifier Aeration Tank-1 Aeration Tank-2 Clarifier Sludge Press Paper M/c Mark save all ... flow diagram of Bio-methanation plant at Mill A FLOCCULATION BLACK LIQUOR EQUALISATION TANK 39 SLUDGE DRYING BED GAS HOLDER BIOGAS FOR UTILISATION IN BOILER PRIMARY CLARIFIER NEUTRALISATION TANK...
Ngày tải lên: 22/02/2014, 09:20
Báo cáo khoa học: Identification of small scale biochemical networks based on general type system perturbations pdf
... supplementary material.) Having determined an estimation Ad for Ad, an estimation for the continuous time Jacobian A can be obtained using the above transformations We will demonstrate that Eqn ... following, show how an estimation Ad for the discrete time Jacobian Ad can be determined An estimation A for the continuous time Jacobian A can then be calculated through a reverse transformation to continuous ... transcription, and a bar indicates a negative effect gene with relatively fast dynamics (The equations, parameters, and the nominal Jacobian are given in part seven of the supplementary material.)...
Ngày tải lên: 07/03/2014, 17:20