a productive partnership between civil society and the academy

... Chaloupek Hans A Frambach Editors Legacy and Lessons for Civil Society and the State Trang 2The European Heritage in Economics and the Social SciencesTrang 3The European heritage in economics and the ... Chaloupek, and Hans A Frambach Gustav Schmoller’s Program and Its Valuation Today and Tomorrow 7 Gustav Schmoller and Adolph Wagner: The Idea of Social Justice in Health Care 49 Ursula Backhaus ... of a descriptive and a theoretical approach The descriptive approach focussed on collecting facts about the economy The theoretical approach included an cal investigation and a pure theoretical

Ngày tải lên: 20/01/2020, 10:31

... Chaloupek Hans A Frambach Editors Legacy and Lessons for Civil Society and the State Trang 2The European Heritage in Economics and the Social SciencesTrang 3The European heritage in economics and the ... Chaloupek, and Hans A Frambach Gustav Schmoller’s Program and Its Valuation Today and Tomorrow 7 Gustav Schmoller and Adolph Wagner: The Idea of Social Justice in Health Care 49 Ursula Backhaus ... of a descriptive and a theoretical approach The descriptive approach focussed on collecting facts about the economy The theoretical approach included an cal investigation and a pure theoretical

Ngày tải lên: 03/03/2020, 10:46

... in analyses serves as a potential draw-back as these studies are sensitive to confounding factors and biases, especially recall bias Thus, the association between alcohol intake and pancreatic ... per day), or heavy alcohol (≥24 g per day) intake and the risk of pancreatic cancer The value assigned to each alco-hol intake category was the mid-point for closed categories and the median for ... specific populations and conduct stratified analyses of potential confounding factors to obtain a more detailed analysis of the as-sociation between alcohol intake and the risk of pan-creatic cancer

Ngày tải lên: 21/09/2020, 09:24

... individual against the community, this dissertation attempts a more integrated and synthetic conceptual framework that emphasizes the creative tension and interaction between the individual and the ... seems to have described … is not the New England town but a particular and perhaps numerically dominant type of Massachusetts town at a rather early and static stage of economic and social development.” ... natural inequality Trang 15and an acceptance of a more liberal social order that recognizes self-interest as the legitimate means to achieve autonomy and equality The American Revolution culminated

Ngày tải lên: 04/04/2021, 22:57

... indicating that the pandemic has a favorable impact on PR. 4.6.3 Correlation Analysis between RI, PV and PR Table 4.12: Correlation Analysis between RI, PV and PR The correlation between RI and ... variables and scales, while factor loading represents the correlation coefficient between variables and factors.35 value of the accumulative variance explains whether the factors in the research ... time-consuming and costly (Baggio and Klobas 2011), it offers significant advantages It enables researchers to target specific sample audiences (Ghauri and Gronhaug 2010) and allows for data that is relevant,

Ngày tải lên: 19/05/2023, 22:29

... strategies 28 Management, governance and markets 29 Migration and land tenure 29 Climate change-related research needs 29 Health and transmission-related research needs 30 Issues of Scale 31 A ... Community Based Organization ESARO Eastern and Southern Africa Regional Ofce EKZNW Ezemvelo KwaZulu Natal Wildlife FAO United Nations Food and Agriculture Organization GO Governmental Organization ... without the intellectual and nancial support of a number of organizations and individuals. We would like to thank International Union for the Conservation of Nature-Eastern and Southern Africa Regional

Ngày tải lên: 28/06/2014, 19:20

... libraries and other information resources and databases The library is primarily a place to keep and disseminate such information and documentation Therefore, information and documentation in li-brary ... information and reliably disseminate information Information, documentation and library are organically interrelated; and certainly, infor-mation – documentation activities and library activities are ... education and training, the teacher plays the role of providing orientation and guidance learn-Through the storage and preservation and dissemination of documents, library also nates cultural values

Ngày tải lên: 23/07/2014, 17:44

... constant (Pa K–1), respectively Ts and Ta are air and leaf temperatures, and es and ea are the water vapour pressure in the substomatal spaces and in the air, respectively Conductances gb and ... heat, momentum characterised by vertical and horizontal wind speed) and gas (water vapour, CO2 and other biogenic gases) content of the air Heat and gas contents of the air are called “scalars” ... temperature and humidity) not show large spatial variations, and/or these spatial variations not have large effects on CO2 and H2O fluxes between the tree and the atmosphere (this is particularly

Ngày tải lên: 08/08/2014, 14:22

... Surgeon General. Atlanta, GA: Centers for Disease Control and Preven- tion; 1996. 3. Mathers E, Vos T, Stevenson C: The Burden of Disease and Injury in Australia. Canberra, Australia: Australian Institute ... knee OA must be valid, reliable and sensitive to change among healthy and OA populations 3 Instruments for the measurement of physical activity must be reliable and valid, and able to assess accurately ... P: A case-control study to investigate the relation between low and moderate levels of physical activity and osteoarthritis of the knee using data collected as part of the Allied Dunbar National

Ngày tải lên: 09/08/2014, 10:22

... (5’ -CAAGCTGGAGGTGAC TC- TACTGAGAACTTTGAGG-3’ )andA59S-F(5’ -CA AGCTGGAGGTGAC TCTACTGAGAACTTTGAGG- 3’); for G67A, G67A-R(5’-GGCATCTGTAGAGTG CGC- GACATCCTCAAAGTTC-3’)andG67A-F(5’ -GAAC TTTGAGGATGTC ... TCCCCACC-3’)andL51T-F (5’ -GGTGGGGAAGAAGTT ACAAGGGAACAAGCT GG-3’); for A59V, A59V-R (5’-CCTCAAAGTTCTCAG- T AACGTCACCTCCA GCTTG-3’) and A59V-F (5’-CAA GCTGGAGGTGAC GTTACTGAGAACTTTGAGG-3’); for A59 S, A59S-R ... GCGCACTCTACAGATGCC-3’ ); and for G67 S, G67S-R (5’ -GGCATCTGTAGAGTG C- GAGACATCCTCAAAGTTC-3’)andG67S-F(5’ -GAA CTTTGAGGATGTC TCGCACTCTACAGATGCC-3’ ). After the si te-directed mutagenesis, transformation,

Ngày tải lên: 10/08/2014, 05:21

... adjescent to the bri1-301 mutation was amplified in a polymerase chain reaction (PCR) with the primer set 5’-ggaaaccattgggaagatca-3’ (forward) and 5’-gctgtttcacccatccaa-3’ (reverse) and then digested ... (1M NaCl, 1% SDS, 1% dextran sulfate (Sigma Aldrich), and 50% formamide) For the RT-PCR analysis, the RNA was treated with RNase-free RQ1 DNases (Promega), and the first-strand cDNA was synthesized ... of the primers used were a 5-cgttagatctcagcttcaacaatttctccgg-3’ (forward) and 5’-ccggagaaattgttgaagctgagatctaacg-3’ (reverse) All of the resulting plasmids were fully sequenced to confirm the

Ngày tải lên: 11/08/2014, 11:21

... TTCAAGGAGTACCTCTCTCTAG 3′; CXCL10 RP 5′ CTGGATTCAGACATCTCTTCTC 3′; CCL5 FP 5′ TACCATGAAGGTCTCCGC 3′; CCL5 RP 5′GACAAAGACGACTGCTGG 3′; b-ACTIN FP 5′ CATGAAGTGT GACGTGGACATCC 3′; b- ACTIN RP 5′ GCTGATCCACATCTGGAAGG ... cells: a comparative analysis between highly pathogenic and modified H5N1 viruses Alok K Chakrabarti*, Veena C Vipat, Sanjay Mukherjee, Rashmi Singh, Shailesh D Pawar, Akhilesh C Mishra Abstract Background: ... performed the experiments AKC, VCV, SM performed data analysis and bioinformatics studies AKC, SM and ACM wrote the paper All authors read and approved the final manuscript Competing interests The authors

Ngày tải lên: 12/08/2014, 01:21

... Briefly, each video frame (grayscale) was subtracted from an image without a rat in the arena and then Trang 10thresholded to obtain a binomial image The centroid of the animal was obtained for frames ... percentage stance times of 0 and a gait symmetry variable of approximately 0.5 A shift in either of these variables would indicate a shift away from balanced, symmetric gait For the statistical analyses ... in a custom-built gait arena (5’6” x 1’6”) preoperatively and again on day 5 The arena is composed of a glass floor, three transparent acrylic sides, a black acrylic back, black acrylic top, and

Ngày tải lên: 12/08/2014, 17:22

... contributions TS and EEN designed the research, AK, AS, YS, and EEN performed the research, TS, MN, AA, and EEN analyzed the data, and AA, HA, TS, and EEN wrote the paper Acknowledgements The authors ... Science, and Technology, and the Ministry of Health, Labour and Welfare, Japan. References 1. Shibata R, Sakai H, Kawamura M, Tokunaga K, Adachi A: Early rep-lication block of human immunodeficiency ... shioda@biken.osaka-u.ac.jp; Masako Nomaguchi - nomaguchi@basic.med.tokushima-u.ac.jp; Akio Adachi - adachi@basic.med.tokushima-u.ac.jp; Hirofumi Akari - akari@nibio.go.jp; Emi E Nakayama* - emien@biken.osaka-u.ac.jp

Ngày tải lên: 12/08/2014, 23:21

... 4003–4012 Hamada FN, Koshiyama A, Namekawa SH, Ishii S, Iwabata K, Sugawara H, Nara TY, Sakaguchi K & Sawado T (2007) Proliferating cell nuclear antigen (PCNA) interacts with a meiosis-specific RecA homologue, ... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG ... Schematic diagram of the truncation mutants of CcCac1L (C) Interaction between CcCac1L and CcLim15 in a yeast two-hybrid assay The inserts in the activation domain (AD) and DNA-binding domain...

Ngày tải lên: 07/03/2014, 05:20

... management reports and accounts which provide accurate and timely financial as well as statistical information and data required by accounting management agents in a company to make day-to-day ... Relevance Lost: The Rise and Fall of Management Accounting, “innovations such as activity-based costing/management, the balanced scorecard, value-chain analysis and economic value-added systems have ... processes, and managerial accounting systems compatible with the market and the new organizational structure  Attract, motivate and develop talent pool and move towards creating Vietnam’s most desirable...

Ngày tải lên: 13/03/2014, 14:20

... GATAATCTGAAAACC-3¢, MOslr1417-4 5¢-GGAT TTACCACAACCAgctGTTTGATTAGCATT-3¢ and MOslr1417-5 5¢-CCAAAGGATTTACCggcgCCACAGG TTTG-3¢ (lower case type indicates the introduced mutations, new cleavage sites ... (5¢-GATCTAAGCTTAAA CCCCAAAGGATTTACC-3¢) The resulting 376-bp fragment was cleaved with NdeI and HindIII and cloned into the expression plasmid pRSET 5a [23] cleaved with the same enzymes creating the ... 16 Kaneko, T., Sato, S., Kotani, H., Tanaka, A. , Asamizu, E., Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiura, M., Sasamoto, S., Kimura, T., Hosouchi, T., Matsuno, A. , Muraki, A. , Nakazaki,...

Ngày tải lên: 31/03/2014, 01:20

... in the reported importance [Figure 1] The largest differences are between White British participants (almost all of whom rate all the topics as important) and the others, though the Chinese participants ... of variability within each ethnic group and age band: Principal components analyses were conducted on individual OPQOL questions for different ethnic groups and in 5-year age bands, and the resulting ... predicting OPQOL and CASP Importance of leisure aspects and ethnicity had significant interactions predicting OPQOL and CASP Importance of social aspects and ethnicity had significant interactions predicting...

Ngày tải lên: 11/08/2014, 23:22

... in a survey questionnaire and the sample of analyst users was asked to rate the importance of each item on a 5-point scale After standardizing the responses to a zero mean and unit variance, a ... voluntary disclosure Third, the Hong Kong data allows a fuller and more powerful approach to analysis as there is considerable variation in the measures of the explanatory and dependent variables ... mechanism is a governance panacea and suggests that “it is desirable to have a system of overlapping checks and balances.” Therefore, the hypotheses about the effect of internal governance mechanisms...

Ngày tải lên: 06/01/2015, 19:46

... lies abundantly in the landscape and even in the people and candidates fielded by the party Baudrillard (1994, Ch1) argues that such a precession is characteristic of simulation and that it is accompanied ... was too little too late The MCP launched a major military offensive in December of 1948 and the MPAJA was renamed the Malayan National Liberation Army (MNLA) The British response was swift and ... local megamachine we are familiar with today Finally, one important distinction between the colonial megamachine and the local machine was in its treatment of the human being The colonial megamachine...

Ngày tải lên: 03/10/2015, 21:58