... adapter contains a 5’ biotin tag used for mobilization • The beads are magnetized and attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are formed ... ssDNA bead to be loaded into a well • Enzyme beads and packing beads are added Enzyme beads containing sulfurase and luciferase, and packing beads used only to keep the DNA beads in place • Above ... Preparation of the DNA • DNA is fragmented by nebulization • The DNA strand’s ends are made blunt with appropriate enzymes • A and “B” adapters are ligated to the blunt ends using DNA ligase...
Ngày tải lên: 19/03/2014, 22:32
... untreated hypertensive men Psychosom Med 2004, 66(5):633-9 10 Narita K, Murata T, Takahashi T, Hamada T, Kosaka H, Yoshida H, Wada Y: The association between anger-related personality trait and cardiac ... but we are not aware of any study that has examined personality variables and SES in parallel for the prediction of the HRQOL after cardiac rehabilitation Studies that examine influence factors ... significant increase in explained variance for all six HRQOL scales The amount fluctuated between 1.3% and 2.9% and is thus generally greater than the increase in explanation of variance by the characteristics...
Ngày tải lên: 20/06/2014, 16:20
Báo cáo y học: "Pre- and post-bronchodilator lung function as predictors of mortality in the Lung Health Study" pot
... smoking status, race, and educational status Age was classified at baseline, the year 1, and year examinations and was categorized for use in tables (35-39, 40-49, 50-50, and 60 and older), and was ... used as a continuous variable in the survival analyses BMI was categorized at baseline and was categorized into categories ( < 25, 25-29, and >= 30 kg/m2), and was used as a continuous variable ... BR, MacNee W, Agusti A, Anzueto A, Berg B, Buist AS, Calverley PMA, Chavannes N, Dillard T, Fahy B et al.: Standards for the diagnosis and treatment of patients with COPD: a summary of the ATS/ERS...
Ngày tải lên: 12/08/2014, 14:20
Analysis, design and implementation of high performance control schemes for three phase PWM AC DC voltage source converter
... persistence and curiosity displays me a new angle of life and arouse my desire of exploration I am also very fortunate to know Ms Zhou Haihua as a lab-mate and a good friend Her immense enthusiasm leads ... Clark Transformation Matrix and Park Transformation Matrix 194 D Expressions of Average Active and Reactive Power with Symmetrical Components 197 E Hardware Components for Power Converter and ... phasor of the fundamental line side current ia1 uan1 phasor of the fundamental converter voltage ua1 vaL1 phasor of the fundamental voltage on inductance vaL1 idc ,∆idc DC signal and AC signal...
Ngày tải lên: 11/09/2015, 16:02
Analysis, design and control of permanent magnet synchronous motors for wide speed operation
... at the same time Back EMF Phase A 120o Phase B 240o Phase C (a) Back EMF 180o Phase A 120o Phase B 240o Phase C (b) Figure 1.1: Basic excitation waveform for (a) sinusoidal and (b) trapezoidal ... can be greater than Br Small armature reaction flux Higher armature reaction flux PMs not protected against armature field PMs protected against armature field Low PM flux leakage Higher PM flux leakage ... diameter of stator frame dc bare diameter of conductor E rms value of phase back EMF ecoil back EMF in one coil Fad d-axis armature MMF Faq q-axis armature MMF Fa1 , Fb1 , Fc1 phase fundamental MMF...
Ngày tải lên: 15/09/2015, 22:06
Genetic engineering of hybrids of major mite allergens of dermatophagoides pteronyssinus and evaluation of their potential as vaccines for immunotherapy
... GAGAATGACAACATATGGATATTC GATCAAGTCGATGTCAAAGATTGTG TCAATCGCGGATTTTAGCATGAG GAAGATAAAAAACATGATTATCAA TTAAACTTCAATCTTTTTAACACGTGC GATCCAATTCACTATGATAAAATC CTATTGGTTGTTTCGTTCCAATTC Table Primers used in the cloning ... amplified using AFTF-DP1R and AFTF-DP7R forward and reverse primer pairs Primer AFTF DP1F DP2F DP2R DP5F DP5R DP7F DP7R Sequence ACCGGGCTTCTCCTCAACCATGGCG GAGAATGACAACATATGGATATTC GATCAAGTCGATGTCAAAGATTGTG ... RGKPFQLEAV KIEIKASIDG NACHYMKCPL TWNVPKIAPK MGDDGVLACA SSIKTFEEYK EDEEAARKNF GGAINHLSDL MSAEAFEHLK ACSINGNAPA TPIRMQGGCG TESAYLAYRN VDCASQHGCH IQHNGVVQES CRRPNAQRFG NVNKIREALA GIKDLDAFRH NGYQPNYHAV VDYWIVRNSW...
Ngày tải lên: 07/10/2015, 10:02
Báo cáo khoa học: "Hybrid Parsing: Using Probabilistic Models as Predictors for a Symbolic Parser" docx
... 1999 Head-Driven Statistical Models for Natural Language Parsing Phd thesis, University of Pennsylvania, Philadephia, PA Michael Daum, Kilian Foth, and Wolfgang Menzel 2004 Automatic transformation ... Shallow Analyses - Formalisms and statistical modeling for deep analyses, Sanya City, China Hiroshi Maruyama 1990 Structural disambiguation with constraint propagation In Proc 28th Annual Meeting ... (monolingual) language models A similar architecture has been adopted by (Wang and Harper, 2004) who train an n-best supertagger and an attachment predictor on the Penn Treebank and obtain an labelled...
Ngày tải lên: 31/03/2014, 01:20
FINANCIAL ANALYSIS: TOOLS AND TECHNIQUES CHAPTER 10 pot
... conditions Analytical Support Financial Genome, the commercially available financial analysis and planning software described in Appendix I, has the capability to develop and display fullfledged financial ... and offset on the liability side by the capitalized value of the lease payments In effect, a capital lease has a recorded impact quite similar to a secured loan arrangement, and the total lease ... financial analyses under different financing assumptions from input data and built-in databases The software is also accompanied by an interactive template (TFA Template under “extras”), which allows...
Ngày tải lên: 01/07/2014, 22:20
Module V Viruses and Worms.Introduction to VirusComputer viruses are perceived as a threat to potx
... load than normal Computer's hard drive constantly runs out of free space Files have strange names which are not recognizable Programs act erratically Resources are used up easily Hardware Threats ... program ti due to i l t f data in Software Attacks: • Intentionally launched malicious programs enable the attacker to use the computer in an unauthorized manner • General Categories: • Viruses and ... and infect at later stages Attack Phase: • Some viruses have trigger events to activate and corrupt systems • Some viruses have bugs that replicate and perform activities like file deletion and...
Ngày tải lên: 31/07/2014, 04:20
Manual for Soil Analysis-Monitoring and Assessing Soil Bioremediation Phần 10 doc
... is affected by several parameters Water content, temperature (Blagodatskaya et al 1996), the quality of the soil organic matter (Wander 2004), as well as contaminants (e.g., Blagodatskaya and Anan’eva ... methods for the characterization of soil microbial activity and biomass Basal respiration gives information on the actual state of microbial activity in the soil After addition of an easily biodegradable ... fresh water algal growth inhibition assay is performed according to the standard ISO 8692 (1989) It is applicable both for the 332 A Eisentraeger et al characterization of chemicals and aquatic...
Ngày tải lên: 08/08/2014, 01:20
Poverty Impact Analysis: Approaches and Methods - Chapter 10 pps
... tariff tiers and the maximum tariff rates In particular, the program was aimed at establishing a four-tier tariff schedule, namely: a percent rate for raw materials and capital equipment not available ... ArcView Desktop, ChartFX Graph Generator, Autodesk Map, and MapGuide 6.5 Advanced GIS Analysis Malaysia, Singapore, and Thailand also have CGE models In general, all countries can be included in the ... scenarios: partial trade liberalization or the application of a low uniform tariff, actual tariff reduction, and full tariff reduction.6 The first scenario involved the application of a uniform tariff...
Ngày tải lên: 08/08/2014, 10:23
Báo cáo y học: "Anti-Sa antibodies and antibodies against cyclic citrullinated peptide are not equivalent as predictors of severe outcomes in patients with recent-onset polyarthritis" pdf
... of anti-Sa increased after adjustment for all other included variables Although antiSa was the best individual marker for severity, a combination of anti-Sa, an SvH erosion score of at least and ... the assay The objectives of current anti-CCP assays are to attain the maximal sensitivity for patients with established RA or RA-like disease, while maintaining a reasonable specificity This approach ... months happened mostly in those patients who already had significant erosive joint damage at first evaluation Early erosive changes are therefore an excellent surrogate marker for an aggressive arthritis...
Ngày tải lên: 09/08/2014, 06:22
Thermal Analysis - Fundamentals and Applications to Polymer Science Part 10 pot
... Figure 6.11 shows a schematic stress strain curve where a tensile force is applied at a uniform rate to a viscoelastic sample at a constant temperature The shape and characteristic parameters of the ... place during deformation Soft materials and films use clamps which are flat to avoid penetration or tearing When operating in shear mode flat-faced clamps, or clamps with a small nipple to retain ... DSC, for all scanning rates, the likelihood of radiation damage is high The sample vessel for simultaneous DSC-X-ray analysis must be made from materials of high transparency to X-rays and low...
Ngày tải lên: 10/08/2014, 12:21
Introdution to Thermal Analysis Techniques and Applications Part 10 ppt
Ngày tải lên: 11/08/2014, 09:21
Soil and Environmental Analysis: Physical Methods - Chapter 10 docx
... structural units, may penetrate aggregates or planes of weakness between aggregates, whereas a large cone will tend to deform aggregates (Jamieson et al., 1988) C Shaft Diameter The surface area of a ... sample on a moving platform toward a stationary probe (Eavis, 1967) The movable crosshead of a strength testing machine has a convenient drive capable of a wide range of speeds, and can accept force ... significant advantage Exceptions are saturated clay (Turnage, 1973) and soils with a strong layer overlying a weak layer The large force required to penetrate the strong layer may cause an excessive...
Ngày tải lên: 11/08/2014, 15:20
Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx
... hospital, and the dose and pattern of administration were in accordance with current standards Failure of organs was evaluated using the Sequential Organ Failure Assessment (SOFA) scale on admission ... stratified analysis was performed before the multivariate analysis using the Mantel-Hanszel χ2 test, in order to evaluate the presence of interactions and confounding factors among variables A multivariate ... mortality A bivariate analysis of risk factors for in-hospital mortality is reported in Table The mortality rate was significantly higher for females than for males Neither microbiological documentation...
Ngày tải lên: 13/08/2014, 01:20
System Analysis, Design, and Development Concepts, Principles, and Practices phần 10 doc
... Establish statistical performance benchmarks via baselines, where applicable, for WHAT constitutes actual nominal system performance For example, your car’s gas mileage has a statistical mean ... adversarial system performance Reason 6: To Validate Models and Simulations VALIDATE laboratory models and simulations against actual system performance to support future mission planning or assess ... several focus areas: Focus Area 5: Perform and maintain a “gap” analysis Focus Area 6: Bound and partition the problem and solution spaces Focus Area 7: Formulate and develop new capability requirements...
Ngày tải lên: 13/08/2014, 08:21
Báo cáo y học: "Tiling microarray analysis of rice chromosome 10 to identify the transcriptome and relate its expression to chromosomal architecture" pptx
... to environmental changes [39,40,59] Materials and methods Plant materials and treatments Oryza sativa ssp japonica cv Nipponbare and Oryza sativa ssp indica cv 93-11 were used for all experiments ... 12 13 14 15 Additional data files The following additional data files are available with the online verison of this paper Additional data file contains a table of integrated japonica chromosome ... nonredundant gene models Additional data file contains a table of indica chromosome 10 nonredundant gene models Additional data file contains a table of the sequence analysis of cloned UG models Additional...
Ngày tải lên: 14/08/2014, 14:21