... come from packages that are usually grouped by functionality The packages are typically installed and managed using a package manager Red Hat's Package Manager (rpm ) is a popular example and is ... Uninitialized global variable */ int data_var = 1; /* Initialized global variable */ int main(int argc, char **argv) { void *stack_var; /* Local variable on the stack */ stack_var = (void *)main; ... Christopher Hallinan 0131679848, Paper, ©2007 SELinux by Example Frank Mayer, David Caplan, Karl MacMillan 0131963694, Paper, ©2007 UNIX to Linux® Porting Alfredo Mendoza, Chakarat Skawratananond, Artis...
Ngày tải lên: 28/06/2014, 18:20
... compensation The mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, that is, parents) Many team members also expect the manager to play almost a parental role ... Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey Technical ... taking a break due to family or medical issues Disturbances can be long drawn, like the SARS (a deadly virus that spreads in the air from human-to-human) threat that created a fear of travel among...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "A Connectionist Approach to Prepositional Phrase Attachment for Real World Texts" docx
... possible reason for low performance using classes is that WordNet is not an adequate hierarchy since it is hand-crafted Ratnaparkhi et al (1994), instead of using hand-crafted semantic classes, uses ... (attachment) behaviour, and that there are fewer semantic classes than there are words, the problem of data sparseness and memory space can be considerably reduced Some of the class-based methods have used ... look-up tables The use of semantic classes has been suggested as an alternative to word co-occurrence If we accept the idea that all the words included in a given class mu'st have similar (attachment)...
Ngày tải lên: 31/03/2014, 04:20
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
... Turkish patients Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; ... primary clinical efficacy end points included major adverse cardiac events (MACE) at two year (MACE: Death, myocardial infarction, target vessel revascularization (TVR) Target vessel revascularization ... 30 days; late, >30 days and very late, >1 year) Myocardial infarction was defined as a creatine kinase (CK) elevation >2 times above the upper limit of normal levels with any associated elevation...
Ngày tải lên: 25/10/2012, 11:18
Báo cáo y học: " A Practical Approach to Managing Patients with HCV Infection"
... Am J Gastroenterol 1998;93(1):44-8 29 Giannini E, Risso D, Botta F, et al Validity and clinical utility of the aspartate aminotransferase-alanine aminotransferase ratio in assessing disease severity ... level correlates poorly with liver histology, the ratio of aspartate aminotransferase (AST) to alanine aminotransferase (ALT) >1 is a dependable marker for cirrhosis [28,29] Increased INR and thrombocytopenia ... further evaluated by a HCV RNA test HCV RNA can be measured either quantitatively or qualitatively, which can approach a low limit of detection of 50 IU/ml or 100 viral copies/ml as early as 1-2...
Ngày tải lên: 02/11/2012, 09:51
Báo cáo y học: "A Practical Approach to Management of Chronic Hepatitis B"
... years, ALT has been used as a standard surrogate for the activity of CHB Thus, ALT level in combination with HBV DNA level and histological activity has been used as a determinant for HBV treatment ... normal transaminases have historically not been considered as candidates for HBV treatment based on the assumption that these patients usually have a slow progression and evidence that these patients ... management of CHB that well summarized current standard practice [1-3] Through a systematic review of the literature, this article is aimed to provide a step-wise updated and practical clinical...
Ngày tải lên: 03/11/2012, 09:41
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa ... Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ...
Ngày tải lên: 05/09/2013, 10:15
Tài liệu Real-World ASP.NET—Building a Content Management System pptx
... components and metacontent in one place makes them easier to maintain, track, and find It also provides a more secure way of storing your data Having your data localized means you have a smaller area ... arranged on a Web page for viewing A good CDA should have no real say in the layout of a content component What a CDA should is provide a way to make suggestions to the MMA about the layout and ... known as personalization (Chapter covers personalization in more detail.) You can also see that the left side of the page is made up of a navigation bar You can find navigation bars (NavBars)...
Ngày tải lên: 10/12/2013, 14:15
A real time approach to process control 2ed
... For undergraduate programs looking to transition away from the traditional mathematical-based approach to a more applied, hands-on approach, this text will be an invaluable aid.’ Charles F Moore, ... scheme and load variables much as the operator of a plant observes the behaviour of an actual plant Dynamic simulation allows for the comparison of several candidate control strategies and assesses ... control hardware fundamentals P2 P2 P1 H Area = A L Area = a θ Inclined Limb Manometer ⎞ a P2 − P1 = rgL ⎜ + sin q⎟ ⎠ A Typical Manometer P2 − P1 = rgH P2 P1 Area = A Area = a H Single Limb Manometer...
Ngày tải lên: 01/01/2014, 17:44
Tài liệu BUSINESS Undergraduate courses 2013: a university for the real world pdf
... program to maintain relationships for real- world organisations As a consultant, your final year at QUT involves a real- world project where you pitch an idea to a real- world client and prepare a campaign ... Australasian Writers and Art Directors Association and the Australian Direct Marketing Association A real graduate’s story Business graduate Kaya Lobaczewski talks about QUT and how it landed her a ... interests and aspirations All nine majors in the Bachelor of Business are available at QUT’s Gardens Point campus The Marketing and Management majors are also available at QUT’s Caboolture campus...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Teaching IT Project Management to Postgraduate Business Students: A Practical Approach ppt
... with an external organisation to apply the concepts and techniques learnt in class It can be argued that these challenges and approaches also apply to teaching IT Project Management For a project ... installation tasks were able to commence a little ahead of schedule All work proceeded according to plan and, apart from the Broadband installation that has just commenced all these tasks are ... suggest that there is considerable variation in the way that the theoretical and practical aspects of the material are handled While many university courses make use of project management software...
Ngày tải lên: 18/02/2014, 07:20
Tài liệu Design for Sustainability a practical approach for Developing Economies doc
... Office for Africa, Kenya Mr Zhao Ming,Tsinghua University Beijing, China Mr Sergio Musmanni, CNPML, Costa Rica Dr Kasimoni Patrick Mwesigye, UCPC, Uganda Ms Maria Amalia Porta, CGPML, Guatemala Mr ... Regional Office of North America, United States of America Mr Alex Saer Saker, ODES, Colombia Dr Nurelegne Tefera, Addis Abbaba University, Ethiopia Mr B.S Samarasiri, Moratuwa University, Sri Lanka ... Lanka Prof Dr John Turyagyanda, Makerere University, Uganda Dr Sonia Valdivia, UNEP DTIE, France Design and lay-out Ms Ana Mestre and Ms Gra a Campelo, SUSDESIGN, Portugal Photography Mrs Carmen...
Ngày tải lên: 21/02/2014, 05:20
A Practical Approach to Water Conservation for Commercial and Industrial Facilities pot
... Shanghai Dhaka Delhi Buenos Aires Jakarta Osaka Rio de Janeiro Karachi Japan Mexico Brazil USA India USA India China Bangladesh India Argentina Indonesia Japan Brazil Pakistan Source: UN Habitat: ... North America Central America North Africa Central and South Asia Middle East Southeast Asia Central Africa South America Southern Africa Oceanania Virtual water trade balances of thirteen world ... A Practical Approach to Water Conservation for Commercial and Industrial Facilities A Practical Approach to Water Conservation for Commercial and Industrial Facilities Mohan Seneviratne...
Ngày tải lên: 06/03/2014, 17:20
Practical packet analysis Using Wireshark to Solve Real-World Network Problems ppt
... PRACTICAL PACKET ANALYSIS PRACTICAL PACKET ANALYSIS U s in g W i r e s h a r k t o S o l v e Real- World Network Problems b y C h r is S an d e r s ® San Francisco PRACTICAL PACKET ANALYSIS ... Concepts and Approach I am generally a really laid-back guy, so I when I teach a concept, I try to so in a really laid-back way This holds true for the language used in this book It is very easy to ... course, as an educational text that you will read through, chapter by chapter, in order to gain an understanding of packet analysis This means paying particular attention to the real- world scenarios...
Ngày tải lên: 16/03/2014, 12:20
Biomarkers in marine organisms a practical approach
... Hybridisation with mammalian and fish probes ( 3A, 1 1A) Woottonet al., 1995 A polyelonal antibody raised against perch (Perca fluviatilis) hepatic CYP 1A immunoreacted with a CYP 1A- like epitope of a partially ... 1995) whereas EROD activities have been indicated in the bivalves Donax trunculus and Brachidontes variabilis and the gastropods Patella caerulea and Avicularia gibbosula (Yawetz et al., 1992) ... metallothionein evaluation in marine organisms: an application to Mediterranean and Antarctic molluscs Mar Environ Res 44 (1997) 69-84 16 A. R Walsh and J O'Halloran Accumulation of chromium by a population...
Ngày tải lên: 16/03/2014, 18:10
A Practical Approach to Cardiovascular Medicine ppt
... of Cardiology Stanford University School of Medicine Stanford, CA, USA List of Abbreviations 6MWT AAA ABG ABI ABPM ACC ACE-I ACR ACS ADA AF AHA AI AIVR AMR AR ARB ARVC ARVD 6-min walk test abdominal ... Maranda, and Sharon Hunt Section IV Valvular and Vascular Disease Chapter 10 Valvular Heart Disease, 119 Reza Ardehali and Ingela Schnittger Chapter 11 Diseases of the Aorta, 139 Michael Ho and David ... Perez and Amin Al-Ahmad Chapter 14 Supraventricular Tachycardia, 177 Marco Perez and Paul Zei Chapter 15 Ventricular Tachycardia, 194 Jeffrey Hsing and Henry Hsia Chapter 16 Bradycardia, 204...
Ngày tải lên: 24/03/2014, 02:20
network administrator street smarts - a real world guide to comptia network+ skills
... You also need a computer with a serial port and the appropriate adapters for any devices you have that require serial attachment for configuration but no external MAC address labeling Caveat Ethernet ... administration of a real- world network Scenario You are the network administrator of a regional site that is part of a larger internetwork implemented by a multinational organization Your company has offices ... disclaim all warranties, including without limitation warranties of fitness for a particular purpose No warranty may be created or extended by sales or promotional materials The advice and strategies...
Ngày tải lên: 25/03/2014, 11:53
a practical approach to pharmaceutical policy
... APAPP_i-xxii.qxd 5/21/10 11:45 AM Page i A Practical Approach to Pharmaceutical Policy APAPP_i-xxii.qxd 5/21/10 11:45 AM Page ii APAPP_i-xxii.qxd 5/21/10 11:45 AM Page iii A Practical Approach ... syndrome Arastırmacı Ilaç Firmaları Dernegi, or Association of ¸ ˘ Research-Based Pharmacies (Turkey) Affordable Medicines Facility—malaria active pharmaceutical ingredient anatomical therapeutic ... of large pharmaceutical companies started their careers in sales and marketing APAPP_11-38.qxd 16 5/21/10 11:47 AM Page 16 A Practical Approach to Pharmaceutical Policy and were promoted because...
Ngày tải lên: 26/03/2014, 14:07
fuzzy logic a practical approach - f. martin mcneill, ellen thro
... saying, ”As far Fuzzy Logic A Practical Approach by F Martin McNeill and Ellen Thro Chapter 1: The Fuzzy World 11 as the laws of mathematics refer to reality, they are not certain, and as far as they ... recognizes that some questions by their nature may always have uncertain aspects or involve balancing tradeoffs Figure 1.10: An estimator may agree partially Fuzzy Logic A Practical Approach by F Martin ... second or jarring a passenger Japanese consumer product giants such as Matsushita and Nissan have also climbed aboard the fuzzy bandwagon Matsushita’s fuzzy vacuum cleaner and washing machine are found...
Ngày tải lên: 31/03/2014, 16:07