... Scientific Rationale for the Inclusion and Exclusion Criteria for Intravenous Alteplase in Acute Ischemic Stroke: A Statement for Healthcare Professionals From the American Heart Association/American ... In addition to the classical non-coding RNAs (ncRNAs), transfer RNA (tRNA) and ribosomal RNA (rRNA), additional families of ncRNAs such as microRNAs (miRNAs), long non-coding RNAs (lncRNAs), ... engorgement, and consolidation Membrane lipid rafts are located at the leading edge of neuronal growth cones, providing an essential plasma membrane platform to establish cellular polarity and to
Ngày tải lên: 15/01/2020, 14:39
... GCTTTCAGTTGAGCTGACCA-3’ and CTN NB1 reverse 5’-GCTTTCAGTTGAGCTGACCA-3’ or Axin2 forward 5’- TGTCTTAAAGGTCTTGAGGGTTG AC-3’ and Axin 2 reverse 5’- CAACAGATCATCCCAT CCAACA-3’ Transcriptome analysis After ... HGS for-ward 5’- CTCCTGTTGGAGACAGATTGGG -3’ and H GS reverse 5’- GTGTGGGTTCTTGTCGTTGAC -3’, 18S forward 5’-GTAACCCGTTGAACCCCATT-3’ and 18S reverse 5’-CCATCCAATCGGTAGTAGCG-3’, CTNNB1 forward 5’- ... Lescure6, Elaine Del Nery6, Jacques Camonis6, Franck Perez6, Bruno Ragazzon1,2,3and Christine Perret1,2,3,4 Abstract Background: Aberrant activation of the Wnt/β-catenin pathway is a major and frequent
Ngày tải lên: 21/09/2020, 10:24
implication of dorsostriatal d3 receptors in motivational processes a potential target for neuropsychiatric symptoms in parkinson s disease
... implantations, brain processing for immunohistochem-istry and autoradiographic experiments, as well as data and statistical analyses Animals Experiments were performed on male Sprague Dawley rats ... 0.001, sham vs 6-OHDA (sham, n = 8; 6-OHDA, n = 7) AP: Anteroposterior; DLS: dorsolateral striatum; DMS: dorsomedial striatum; l-mSNc: lateral-medial substantia nigra pars compacta; VTA: ventral tegmental ... sham (n = 8) vs 6-OHDA (n = 7) DLS: dorsolateral striatum; DMS: dorsomedial striatum; NAc: nucleus accumbens (D–F) Photographs of autoradiograms obtained at striatal level for sham and 6-OHDA–
Ngày tải lên: 04/12/2022, 14:49
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot
... probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GC-TAMRA3' Thermal cycler parameters included one cycle at 94°C for 2 min, and 45 cycles involving denaturation at 94°C for 10 s annealing at 53°C for 30 s and ... recommendation of the manufacturer(Dharmacon Research, USA) [19] The following sequences were successfully made: siRNA-EGFR sense GGAGCUGCCCAUGAGAAAUdTdT-3' and antisense 5'-AUUUCUCAUG GGCAGCUCCdTdT-3' ... receptordouble stranded RNAsmall interference RNAnon small cell lung cancer Abstract Lung cancer has emerged as a leading cause of cancer death in the world Non-small cell lung cancer (NSCLC) accounts for
Ngày tải lên: 14/08/2014, 19:22
BARRIER DISRUPTION IN STAT6VT TRANSGENIC MICE AS A POTENTIAL MODEL FOR ATOPIC DERMATITIS SKIN INFLAMMATION
... TEWL and decreased skin capacitance in areas adjacent to the application sites, as far as approximately 0.75cm away (Patil, Singh, & Maibach, 1995) It appears that SLS acts in a time-and-dose ... completed each segment of my project and were instrumental to the technical aspects of this project For Dr Ravi Sahu, Dr Mohammed Al-Hassani, Dr Sarita Sehra, Dr Simarna Kaur, Qiaofang Yi, Davina A Lewis, ... suprabasal keratinocytes in a complex biochemical cascade involving phosphatases and proteases into the active form filaggrin (FLG) (Koch, et al., 2000) FLG has a high affinity for keratins and
Ngày tải lên: 24/08/2014, 12:37
DSpace at VNU: Polygonum multiflorum root extract as a potential candidate for treatment of early graying hair
... of primers for zebrafish ef1α (forward primer: CTGGAG GCCAGCTCAAACAT-3' and reverse primer: 5'-ATCAAGAAGAGTAGTACCGCTAGCATTAC-3') MC1R (forward primer: GACCACG GCCTCCTGGATGT-3 and reverse ... 5-GTTGCAGAAGGGGCTGGTGG-3) MITFa (forward primer: 5'-TGTACAGC AATCATGCTCTTCC-3' and reverse primer: 5'-GTCCCCAGCTCCTTAATTCTGTC-3') Tyrosinase (forward primer: CGCAGATGA ACAATGGCTC-3 and reverse ... defect [Figure 5]a Data statistical analysis by GraphPad software (GraphPad Software, Inc., La Jolla, CA 92037 USA) gave the concentration-response curves for lethality and developmental defects [Figure
Ngày tải lên: 12/12/2017, 06:31
Progress in catalysts of reforming methane process - A potential solution for effective use of CO2 - rich natural gas sources
... dry reforming (CO2 reforming) and partial oxidation of methane Dry reforming of methane (DRM) (1) has drawn attention because this process takes advantage of the available CO2 in natural gas reservoirs ... NiO-based catalysts such as coke formation and sintering at high reaction temperatures, many diverse researches from using new carriers to supporting catalyst by alkali, alkaline earth metals and ... supports, leading to a reduction of coke formation and an increase of CO2 adsorption [45] For example, adding a basic Lewis promoter such as alkali metal oxides (Na2O, K2O), alkaline earth (CaO, MgO)
Ngày tải lên: 12/01/2020, 00:26
Integrated farming systems: A potential tool for doubling farmer’s income
... production activities In this approach the whole farm is viewed as a system and interactions among the various Trang 6components are taken in to consideration (Mahapatra and Behera, 2004) and Mahapatra ... small and marginal farms across the country (Rangaswamy et al., 1996; Behera and Mahapatra, 1999) Integrated Farming System (IFS), a component of Farming System Research (FSR), introduces a ... (IFS) for the generation of adequate income and gainful employment year round (Mahapatra, 1992;1994) Farming system approach, therefore, is a viable approach to address the problems of sustainable
Ngày tải lên: 12/03/2020, 21:48
Perineural invasion as a prognostic factor for intrahepatic cholangiocarcinoma after curative resection and a potential indication for postoperative chemotherapy: A retrospective cohort
... invasion, HBsAg hepatitis B surface antigen, AJCC American Joint Committee on Cancer, ALT Alanine aminotransferase, AST Aspartate aminotransferase, PLT Blood platelet, CEA Carcinoembryonic antigen; ... hazard ratio, CI confidence interval, PNI perineural invasion, HBsAg hepatitis B surface antigen, AJCC American Joint Committee on Cancer, ALT Alanine aminotransferase, AST Aspartate aminotransferase, ... surface antigen, AJCC American Joint Committee on Cancer, ALT Alanine aminotransferase, AST Aspartate aminotransferase, PLT Blood platelet, CEA Carcinoembryonic antigen Trang 9regardless of situation
Ngày tải lên: 17/06/2020, 11:39
Up-modulation of PLC-β2 reduces the number and malignancy of triple-negative breast tumor cells with a CD133+ /EpCAM+ phenotype: A promising target for preventing progression of TNBC
... Paola Lanuti2,3, Marco Marchisio2,3, Yasamin Al-Qassab1,4, Federica Vezzali1, Silvano Capitani1,5and Valeria Bertagnolo1* Abstract Background: The malignant potential of triple negative breast ... invasive ductal breast carcinomas Chin Med J (Engl) 2009;122:2763 –9. 8 Aomatsu N, Yashiro M, Kashiwagi S, Takashima T, Ishikawa T, Ohsawa M, Wakasa K, Hirakawa K CD133 is a useful surrogate marker ... financial means to perform the described experiments and to use the Flow Cytometry Facility of the LTTA Center - University of Ferrara, Italy. Availability of data and materials All data generated
Ngày tải lên: 06/08/2020, 03:46
Gamma-glutamyltransferase activity in exosomes as a potential marker for prostate cancer
... Matsuda2, Tomio Arai2, Kengo Horie3, Koji Kameyama3, Taku Kato3, Koichi Masunaga4, Yutaka Kasuya4, Masashi Tanaka5, Kosuke Mizutani3*, Takashi Deguchi3and Masafumi Ito1* Abstract Background: Exosomes ... Trang 1R E S E A R C H A R T I C L E Open AccessGamma-glutamyltransferase activity in exosomes as a potential marker for prostate cancer Kyojiro Kawakami1, Yasunori Fujita1, Yoko Matsuda2, ... cabazitaxel, enzalutamide and abiraterone has expanded treatment options for meta-static CRPC patients [8] Prostate-specific antigen (PSA) has been commonly used as a marker for PC, but it cannot
Ngày tải lên: 06/08/2020, 07:55
Identification of SEC62 as a potential marker for 3q amplification and cellular migration in dysplastic cervical lesions
... Basel Al Kadah1, Markus Greiner2, Andrea Hasenfus3, Rainer-Maria Bohle3, Ingolf Juhasz-Böss4, Erich-Franz Solomayer4and Zoltan Ferenc Takacs4 Abstract Background: Chromosome 3 amplification affecting ... Statistical Package for the Social Sciences v 17.0 (IBM, Chicago, IL, USA) and XLStat Pro (Addinsoft, NY, USA) software Normality test and statistical analysis of cell proliferation and migration ... migration-stimulating oncogene in the carcinogenesis of cervical cancer and constitutes not only a potential marker for 3q26 amplification but also a potential target for anti-cancer treatment Fig
Ngày tải lên: 20/09/2020, 17:55
Circulating MicroRNA-21-3p: A potential biomarker for peste-des petits ruminants virus in naturally infected goats
... outbreaks (Bondri, Nagpur, Umred, Yawatmal) in Maharashtra state, India during year 2017 Nasal swabs and serum sample from PPR suspected animals and blood smears for bacterial investigations were also ... Preeti P Bramhapurkar 1 , Prabhakar A.Tembhurne 1* , S Chandra Sekar 3 , D Muthucheven 3 , Sharvan Sehrawat 4 , Prashant Tarale 1 , Vijay.C.Ingle 1 and Rajeev Kaul 2 1 Department of Veterinary Microbiology ... Res.46,15 10 Pandey, A., Sahu, A.R., Wani, S.A., Saxena, S., Kanchan, S., Sah, V., Rajak, K.K., Khanduri, A., Sahoo, A.P., Tiwari, A.K and Mishra, B., (2017) Modulation of Host miRNAsTranscriptome
Ngày tải lên: 28/09/2020, 17:31
Aurora kinase B is important for antiestrogen resistant cell growth and a potential biomarker for tamoxifen resistant breast cancer
... Trang 1R E S E A R C H A R T I C L E Open AccessAurora kinase B is important for antiestrogen resistant cell growth and a potential biomarker for tamoxifen resistant breast cancer Sarah L Larsen1, ... blot analysis To investigate the effect of barasertib on protein expres-sion and phosphorylation of Aurora kinase A, Aurora kinase B and INCENP, as well as PARP cleavage, parental and fulvestrant ... study, uni- andmultivariate analyses were performed The multivariate analysis included tumor grade, size, nodal status and age as standard covariates Kaplan-Meier life tables with log-rank testing
Ngày tải lên: 30/09/2020, 11:21
DEK is a potential marker for aggressive phenotype and irinotecan-based therapy response in metastatic colorectal cancer
... Sandra Zazo2, Clara Senin3, Maria J Fernandez-Aceñero5, Maria S Soengas4, Federico Rojo2 and Jesus Garcia-Foncillas1* Abstract Background: DEK is a transcription factor involved in stabilization ... Bitarte N, Chopitea A, Gacia-Foncillas J: Oxaliplatin, irinotecan and capecitabine as first-line therapy in metastatic colorectal cancer (mCRC): a dose-finding study and pharmacogenomic analysis ... Goseki N, Matsubara O, Takenaka K, Shichita M, Tanaka K, Shuda M, Yamamoto M: Identification and characterization of genes associated with human hepatocellular carcinogenesis Cancer Res 1999,
Ngày tải lên: 30/09/2020, 13:24
Plasmalemmal Vesicle Associated Protein (PLVAP) as a therapeutic target for treatment of hepatocellular carcinoma
... lead-ing cause of cancer death in men and the sixth leadlead-ing cause among women HCC accounts for 85% of primary liver cancer [2] and is endemic in Southeast Asia and Sub-Saharan Africa Although ... Trang 1R E S E A R C H A R T I C L E Open AccessPlasmalemmal Vesicle Associated Protein (PLVAP) as a therapeutic target for treatment of hepatocellular carcinoma Yun-Hsin Wang1, Tsung-Yen ... from MECA32 mAb The procedures for preparation of MECA32 anti-PLVAP Fab-TF recombinant protein (MECA32-Fab-Fab-TF) are detailed in the Additional file 2 The purified MECA32-Fab-TF was analyzed
Ngày tải lên: 30/09/2020, 14:52
Feline mammary basal-like adenocarcinomas: A potential model for human triple-negative breast cancer (TNBC) with basal-like subtype
... Trang 1R E S E A R C H A R T I C L E Open AccessFeline mammary basal-like adenocarcinomas: a potential model for human triple-negative breast cancer (TNBC) with basal-like subtype David A Wiese1, ... specific for FMAsand were also identified in control DNA obtained from normal cats Discussion This study was designed to investigate FMAs as a potential natural model for human basal-like TNBC FMAs are ... between human breast cancer and FMAs in regard to epidemiology, clinical behavior, pattern of metastasis, and histological features, various studies have been suggested that FMAs are a potential model
Ngày tải lên: 05/11/2020, 06:04
A potential target for tuberculosis drug discovery
... Clp ATPase belongs to the AAA+ superfamily of ATPases AAA+ proteins are generally modulated by a group of otherwise unrelated proteins termed adaptor proteins An adaptor protein serves as an accessory ... adds 11 amino acid tag (AANDENYALAA) to the incomplete protein Proteins tagged with the SsrA peptide are targeted for degradation The C-terminal Ala-Ala residues are critical for SsrA recognition ... the same group demonstrated that mpa and pafA mutants are severely attenuated in a mouse model of infection (Darwin et al., 2005) Mpa is an ATPase that forms hexamers like the Clp ATPase Meanwhile,...
Ngày tải lên: 26/11/2015, 22:38
Tài liệu Commodity-Linked Bonds: A Potential Means for Less-Developed Countries to Raise Foreign Capital doc
... Monetary and Financial Analysis Department Bank of Canada Ottawa, Ontario, Canada K 1A 0G9 jattamensah@bankofcanada.ca The views expressed in this paper are those of the author No responsibility for ... Ottawa, Ontario K 1A 0G9 E-mail: publications@bankofcanada.ca Web site: http://www.bankofcanada.ca Diffusion des publications, Banque du Canada 234, rue Wellington, Ottawa (Ontario) K 1A 0G9 Adresse ... Bank of Canada Working Papers Documents de travail de la Banque du Canada Working papers are generally published in the language of the author, with an abstract in both official languages Les...
Ngày tải lên: 16/02/2014, 02:20
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... of anti-placental alkaline phosphatase-agarose (anti-PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Purification of FN3d–AP was carried out using an AKTA ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system ... cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated...
Ngày tải lên: 19/02/2014, 05:20